Summary ?
GeneID55737
SymbolVPS35
SynonymsMEM3|PARK17
DescriptionVPS35, retromer complex component
ReferenceMIM:601501|HGNC:HGNC:13487|HPRD:06085|
Gene typeprotein-coding
Map location16q12
Pascal p-value0.02
Sherlock p-value0.36
eGeneMyers' cis & trans
SupportG2Cdb.human_BAYES-COLLINS-HUMAN-PSD-CONSENSUS
G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-FULL
CompositeSet

Gene in Data Sources
Gene set name Method of gene setDescriptionInfo
CV:PGCnpGenome-wide Association StudyGWAS
GSMA_IIEGenome scan meta-analysis (European-ancestry samples)Psr: 0.01775 

Section I. Genetics and epigenetics annotation

@eQTL annotation

SNP IDChromosomePositioneGeneGene Entrez IDpvalueqvalueTSS distanceeQTL type
rs10994209chr1061877705VPS35557370.14trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
GenePearson's Correlation Spearman's Correlation
LRRC560.620.58
CSPG50.580.61
SCARF20.560.53
AC011495.30.560.57
PAK60.550.55
KIFC20.540.53
EHBP1L10.540.58
KIF120.540.52
CCDC1060.530.51
TFR20.520.54
Top 10 negatively co-expressed genes
GenePearson's Correlation Spearman's Correlation
PELI2-0.31-0.14
SOX5-0.31-0.13
RBPSUH-0.30-0.25
NFIB-0.30-0.16
CBLB-0.29-0.09
XPR1-0.29-0.10
RNF182-0.29-0.21
TGFBR1-0.29-0.17
PLAG1-0.29-0.23
LRCH1-0.29-0.13

Section III. Gene Ontology annotation

Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005515protein bindingIPI11102511 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0015031protein transportIEA-
GO:0042147retrograde transport, endosome to GolgiNAS11102511 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005829cytosolIDA11102511 
GO:0005737cytoplasmIEA-
GO:0005768endosomeIDA11256614 
GO:0016020membraneIEA-

Section V. Pathway annotation

Pathway namePathway size# SZGR 2.0 genes in pathwayInfo
SENGUPTA NASOPHARYNGEAL CARCINOMA WITH LMP1 UP 408247All SZGR 2.0 genes in this pathway
TURASHVILI BREAST LOBULAR CARCINOMA VS LOBULAR NORMAL UP 9459All SZGR 2.0 genes in this pathway
ZHOU INFLAMMATORY RESPONSE LIVE UP 485293All SZGR 2.0 genes in this pathway
THUM SYSTOLIC HEART FAILURE UP 423283All SZGR 2.0 genes in this pathway
SENESE HDAC3 TARGETS DN 536332All SZGR 2.0 genes in this pathway
RODRIGUES THYROID CARCINOMA POORLY DIFFERENTIATED UP 633376All SZGR 2.0 genes in this pathway
RODRIGUES THYROID CARCINOMA ANAPLASTIC UP 722443All SZGR 2.0 genes in this pathway
ROYLANCE BREAST CANCER 16Q COPY NUMBER UP 6344All SZGR 2.0 genes in this pathway
ROYLANCE BREAST CANCER 16Q COPY NUMBER DN 2619All SZGR 2.0 genes in this pathway
BENPORATH NANOG TARGETS 988594All SZGR 2.0 genes in this pathway
BENPORATH SOX2 TARGETS 734436All SZGR 2.0 genes in this pathway
STARK PREFRONTAL CORTEX 22Q11 DELETION DN 517309All SZGR 2.0 genes in this pathway
BYSTRYKH HEMATOPOIESIS STEM CELL QTL TRANS 882572All SZGR 2.0 genes in this pathway
IVANOVA HEMATOPOIESIS STEM CELL LONG TERM 302191All SZGR 2.0 genes in this pathway
MARSON BOUND BY E2F4 UNSTIMULATED 728415All SZGR 2.0 genes in this pathway
MCCABE BOUND BY HOXC6 469239All SZGR 2.0 genes in this pathway
ACEVEDO LIVER CANCER UP 973570All SZGR 2.0 genes in this pathway
ACEVEDO LIVER TUMOR VS NORMAL ADJACENT TISSUE UP 863514All SZGR 2.0 genes in this pathway
GRADE COLON CANCER UP 871505All SZGR 2.0 genes in this pathway
CHNG MULTIPLE MYELOMA HYPERPLOID DN 2819All SZGR 2.0 genes in this pathway
MILI PSEUDOPODIA HAPTOTAXIS UP 518299All SZGR 2.0 genes in this pathway
KUROKAWA LIVER CANCER EARLY RECURRENCE DN 76All SZGR 2.0 genes in this pathway
NAKAYAMA FGF2 TARGETS 2917All SZGR 2.0 genes in this pathway
PILON KLF1 TARGETS DN 19721213All SZGR 2.0 genes in this pathway
KOINUMA TARGETS OF SMAD2 OR SMAD3 824528All SZGR 2.0 genes in this pathway
FORTSCHEGGER PHF8 TARGETS DN 784464All SZGR 2.0 genes in this pathway
PHONG TNF RESPONSE VIA P38 COMPLETE 227151All SZGR 2.0 genes in this pathway
VANOEVELEN MYOGENESIS SIN3A TARGETS 220133All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-124/5068086m8hsa-miR-506UAAGGCACCCUUCUGAGUAGA
hsa-miR-124brainUAAGGCACGCGGUGAAUGCC