SZGR2

Summary ?

GeneID	558
Symbol	AXL
Synonyms	ARK\|JTK11\|Tyro7\|UFO
Description	AXL receptor tyrosine kinase
Reference	MIM:109135\|HGNC:HGNC:905\|Ensembl:ENSG00000167601\|HPRD:00171\|Vega:OTTHUMG00000182727
Gene type	protein-coding
Map location	19q13.1
Pascal p-value	0.04
Sherlock p-value	0.228
Fetal beta	-0.856
DMG	1 (# studies)
eGene	Myers' cis & trans
Support	CompositeSet

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Nishioka_2013	Genome-wide DNA methylation analysis	The authors investigated the methylation profiles of DNA in peripheral blood cells from 18 patients with first-episode schizophrenia (FESZ) and from 15 normal controls.	1
DNM:Fromer_2014	Whole Exome Sequencing analysis	This study reported a WES study of 623 schizophrenia trios, reporting DNMs using genomic DNA.
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 1

Section I. Genetics and epigenetics annotation

DNM table

Gene	Chromosome	Position	Ref	Alt	Transcript	AA change	Mutation type	Sift	CG46	Trait	Study
AXL	chr19	41758804	T	G	NM_001699 NM_021913	p.611L>V p.620L>V	missense missense			Schizophrenia	DNM:Fromer_2014

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg14892768	19	41725332	AXL		-0.041	0.37	DMG:Nishioka_2013

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	pvalue	qvalue	TSS distance	eQTL type
rs4501739	chrX	35960848	AXL	558		0.03		trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0004714	transmembrane receptor protein tyrosine kinase activity	TAS	neurite (GO term level: 8)	1656220
GO:0000166	nucleotide binding	IEA		-
GO:0004872	receptor activity	IEA		-
GO:0005524	ATP binding	IEA		-
GO:0016740	transferase activity	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0006468	protein amino acid phosphorylation	IEA		-
GO:0007165	signal transduction	TAS		1656220
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0016020	membrane	IEA		-
GO:0005887	integral to plasma membrane	TAS		1656220

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
AXL	JTK11 \| UFO	AXL receptor tyrosine kinase	Axl forms a homodimer.	BIND	12470648
GAS6	AXLLG \| AXSF \| DKFZp666G247 \| FLJ34709	growth arrest-specific 6	-	HPRD	8621659
GAS6	AXLLG \| AXSF \| DKFZp666G247 \| FLJ34709	growth arrest-specific 6	Reconstituted Complex	BioGRID	8939948
GRB2	ASH \| EGFRBP-GRB2 \| Grb3-3 \| MST084 \| MSTP084	growth factor receptor-bound protein 2	Axl interacts with an unspecified isoform of Grb2.	BIND	12470648
GRB2	ASH \| EGFRBP-GRB2 \| Grb3-3 \| MST084 \| MSTP084	growth factor receptor-bound protein 2	-	HPRD,BioGRID	9178760
LCK	YT16 \| p56lck \| pp58lck	lymphocyte-specific protein tyrosine kinase	-	HPRD,BioGRID	9178760
NCK2	GRB4 \| NCKbeta	NCK adaptor protein 2	Axl interacts with an unspecified isoform of Nck2.	BIND	12470648
PIK3R1	GRB1 \| p85 \| p85-ALPHA	phosphoinositide-3-kinase, regulatory subunit 1 (alpha)	Biochemical Activity	BioGRID	9178760
PIK3R1	GRB1 \| p85 \| p85-ALPHA	phosphoinositide-3-kinase, regulatory subunit 1 (alpha)	Axl interacts with an unspecified isoform of p85-alpha.	BIND	12470648
PIK3R2	P85B \| p85 \| p85-BETA	phosphoinositide-3-kinase, regulatory subunit 2 (beta)	Axl interacts with p85-beta.	BIND	12470648
PIK3R2	P85B \| p85 \| p85-BETA	phosphoinositide-3-kinase, regulatory subunit 2 (beta)	-	HPRD,BioGRID	9178760
PIK3R3	DKFZp686P05226 \| FLJ41892 \| p55 \| p55-GAMMA	phosphoinositide-3-kinase, regulatory subunit 3 (gamma)	Axl interacts with p55-gamma.	BIND	12470648
RANBP9	RANBPM	RAN binding protein 9	Axl interacts with RanBPM.	BIND	12470648
SHC1	FLJ26504 \| SHC \| SHCA	SHC (Src homology 2 domain containing) transforming protein 1	ShcA interacts with Axl.	BIND	8610109
SOCS1	CIS1 \| CISH1 \| JAB \| SOCS-1 \| SSI-1 \| SSI1 \| TIP3	suppressor of cytokine signaling 1	Axl interacts with SOCS-1.	BIND	12470648
SRC	ASV \| SRC1 \| c-SRC \| p60-Src	v-src sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog (avian)	-	HPRD,BioGRID	9178760
TENC1	C1-TEN \| C1TEN \| DKFZp686D13244 \| FLJ16320 \| KIAA1075 \| TNS2	tensin like C1 domain containing phosphatase (tensin 2)	-	HPRD,BioGRID	12470648
TENC1	C1-TEN \| C1TEN \| DKFZp686D13244 \| FLJ16320 \| KIAA1075 \| TNS2	tensin like C1 domain containing phosphatase (tensin 2)	Axl interacts with C1-TEN.	BIND	12470648

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
PID DELTA NP63 PATHWAY	47	34	All SZGR 2.0 genes in this pathway
NAKAMURA TUMOR ZONE PERIPHERAL VS CENTRAL UP	285	181	All SZGR 2.0 genes in this pathway
SCHUETZ BREAST CANCER DUCTAL INVASIVE UP	351	230	All SZGR 2.0 genes in this pathway
NAM FXYD5 TARGETS DN	18	11	All SZGR 2.0 genes in this pathway
CHARAFE BREAST CANCER LUMINAL VS BASAL DN	455	304	All SZGR 2.0 genes in this pathway
CHARAFE BREAST CANCER LUMINAL VS MESENCHYMAL DN	460	312	All SZGR 2.0 genes in this pathway
BASAKI YBX1 TARGETS UP	290	177	All SZGR 2.0 genes in this pathway
VECCHI GASTRIC CANCER ADVANCED VS EARLY UP	175	120	All SZGR 2.0 genes in this pathway
OSWALD HEMATOPOIETIC STEM CELL IN COLLAGEN GEL DN	275	168	All SZGR 2.0 genes in this pathway
UDAYAKUMAR MED1 TARGETS DN	240	171	All SZGR 2.0 genes in this pathway
DODD NASOPHARYNGEAL CARCINOMA DN	1375	806	All SZGR 2.0 genes in this pathway
DARWICHE SKIN TUMOR PROMOTER UP	142	96	All SZGR 2.0 genes in this pathway
DARWICHE PAPILLOMA RISK LOW UP	162	104	All SZGR 2.0 genes in this pathway
DARWICHE PAPILLOMA RISK HIGH UP	147	101	All SZGR 2.0 genes in this pathway
DARWICHE SQUAMOUS CELL CARCINOMA UP	146	104	All SZGR 2.0 genes in this pathway
MAHADEVAN IMATINIB RESISTANCE UP	23	15	All SZGR 2.0 genes in this pathway
AMUNDSON GENOTOXIC SIGNATURE	105	68	All SZGR 2.0 genes in this pathway
TSAI RESPONSE TO IONIZING RADIATION	149	101	All SZGR 2.0 genes in this pathway
GROSS HYPOXIA VIA ELK3 UP	209	139	All SZGR 2.0 genes in this pathway
LOPEZ MBD TARGETS	957	597	All SZGR 2.0 genes in this pathway
KOYAMA SEMA3B TARGETS UP	292	168	All SZGR 2.0 genes in this pathway
WU CELL MIGRATION	184	114	All SZGR 2.0 genes in this pathway
MAGRANGEAS MULTIPLE MYELOMA IGLL VS IGLK DN	24	18	All SZGR 2.0 genes in this pathway
MANALO HYPOXIA UP	207	145	All SZGR 2.0 genes in this pathway
LEI MYB TARGETS	318	215	All SZGR 2.0 genes in this pathway
PETROVA ENDOTHELIUM LYMPHATIC VS BLOOD DN	162	102	All SZGR 2.0 genes in this pathway
LI WILMS TUMOR VS FETAL KIDNEY 1 UP	182	119	All SZGR 2.0 genes in this pathway
PETROVA PROX1 TARGETS DN	64	38	All SZGR 2.0 genes in this pathway
MUNSHI MULTIPLE MYELOMA UP	81	52	All SZGR 2.0 genes in this pathway
REN ALVEOLAR RHABDOMYOSARCOMA DN	408	274	All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE DN	1237	837	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 14HR DN	298	200	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 20HR DN	101	70	All SZGR 2.0 genes in this pathway
ZHANG PROLIFERATING VS QUIESCENT	51	41	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 18HR DN	178	121	All SZGR 2.0 genes in this pathway
LEE AGING CEREBELLUM UP	84	58	All SZGR 2.0 genes in this pathway
RODWELL AGING KIDNEY NO BLOOD UP	222	139	All SZGR 2.0 genes in this pathway
RODWELL AGING KIDNEY UP	487	303	All SZGR 2.0 genes in this pathway
ZHANG ANTIVIRAL RESPONSE TO RIBAVIRIN DN	51	32	All SZGR 2.0 genes in this pathway
XU GH1 AUTOCRINE TARGETS UP	268	157	All SZGR 2.0 genes in this pathway
BAELDE DIABETIC NEPHROPATHY DN	434	302	All SZGR 2.0 genes in this pathway
KRASNOSELSKAYA ILF3 TARGETS DN	46	38	All SZGR 2.0 genes in this pathway
JI RESPONSE TO FSH UP	74	56	All SZGR 2.0 genes in this pathway
ZHENG BOUND BY FOXP3	491	310	All SZGR 2.0 genes in this pathway
COATES MACROPHAGE M1 VS M2 UP	81	52	All SZGR 2.0 genes in this pathway
OSADA ASCL1 TARGETS DN	24	20	All SZGR 2.0 genes in this pathway
ACEVEDO LIVER TUMOR VS NORMAL ADJACENT TISSUE DN	274	165	All SZGR 2.0 genes in this pathway
BOQUEST STEM CELL UP	260	174	All SZGR 2.0 genes in this pathway
NAKAMURA METASTASIS	47	28	All SZGR 2.0 genes in this pathway
WEST ADRENOCORTICAL TUMOR DN	546	362	All SZGR 2.0 genes in this pathway
QI PLASMACYTOMA UP	259	185	All SZGR 2.0 genes in this pathway
FIRESTEIN PROLIFERATION	175	125	All SZGR 2.0 genes in this pathway
JIANG TIP30 TARGETS UP	46	28	All SZGR 2.0 genes in this pathway
SWEET LUNG CANCER KRAS UP	491	316	All SZGR 2.0 genes in this pathway
MILI PSEUDOPODIA CHEMOTAXIS DN	457	302	All SZGR 2.0 genes in this pathway
MILI PSEUDOPODIA HAPTOTAXIS DN	668	419	All SZGR 2.0 genes in this pathway
JISON SICKLE CELL DISEASE UP	181	106	All SZGR 2.0 genes in this pathway
KOBAYASHI EGFR SIGNALING 24HR DN	251	151	All SZGR 2.0 genes in this pathway
MIKKELSEN ES ICP WITH H3K4ME3	718	401	All SZGR 2.0 genes in this pathway
MIKKELSEN NPC ICP WITH H3K4ME3	445	257	All SZGR 2.0 genes in this pathway
SASSON RESPONSE TO GONADOTROPHINS DN	87	66	All SZGR 2.0 genes in this pathway
SASSON RESPONSE TO FORSKOLIN DN	88	68	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 30MIN DN	150	99	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 2HR DN	49	33	All SZGR 2.0 genes in this pathway
CHICAS RB1 TARGETS GROWING	243	155	All SZGR 2.0 genes in this pathway
CHICAS RB1 TARGETS CONFLUENT	567	365	All SZGR 2.0 genes in this pathway
LU EZH2 TARGETS DN	414	237	All SZGR 2.0 genes in this pathway
JOHNSTONE PARVB TARGETS 3 DN	918	550	All SZGR 2.0 genes in this pathway
ISSAEVA MLL2 TARGETS	62	35	All SZGR 2.0 genes in this pathway
PASINI SUZ12 TARGETS DN	315	215	All SZGR 2.0 genes in this pathway
WIEDERSCHAIN TARGETS OF BMI1 AND PCGF2	57	39	All SZGR 2.0 genes in this pathway
GOBERT OLIGODENDROCYTE DIFFERENTIATION DN	1080	713	All SZGR 2.0 genes in this pathway
FORTSCHEGGER PHF8 TARGETS DN	784	464	All SZGR 2.0 genes in this pathway
LIM MAMMARY STEM CELL UP	489	314	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-24	1774	1780	1A	hsa-miR-24^SZ	UGGCUCAGUUCAGCAGGAACAG
miR-34/449	44	51	1A,m8	hsa-miR-34a^brain	UGGCAGUGUCUUAGCUGGUUGUU
				hsa-miR-34c	AGGCAGUGUAGUUAGCUGAUUGC
				hsa-miR-449	UGGCAGUGUAUUGUUAGCUGGU
				hsa-miR-449b	AGGCAGUGUAUUGUUAGCUGGC
miR-9	1396	1402	m8	hsa-miR-9^SZ	UCUUUGGUUAUCUAGCUGUAUGA

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: AXL