Gene Page: CTTNBP2NL
Summary ?
| GeneID | 55917 |
| Symbol | CTTNBP2NL |
| Synonyms | - |
| Description | CTTNBP2 N-terminal like |
| Reference | MIM:615100|HGNC:HGNC:25330|Ensembl:ENSG00000143079|HPRD:10906|Vega:OTTHUMG00000011154 |
| Gene type | protein-coding |
| Map location | 1p13.2 |
| Pascal p-value | 0.005 |
| DMG | 1 (# studies) |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DMG:Nishioka_2013 | Genome-wide DNA methylation analysis | The authors investigated the methylation profiles of DNA in peripheral blood cells from 18 patients with first-episode schizophrenia (FESZ) and from 15 normal controls. | 1 |
| GSMA_I | Genome scan meta-analysis | Psr: 0.0235 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
| Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
|---|---|---|---|---|---|---|---|
| cg20648108 | 1 | 112939192 | CTTNBP2NL | -0.021 | 0.84 | DMG:Nishioka_2013 |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0005730 | nucleolus | IDA | 18029348 | |
| GO:0005737 | cytoplasm | IDA | 18029348 | |
| GO:0015629 | actin cytoskeleton | IDA | 11256614 |
Section IV. Protein-protein interaction annotation
| Interactors | Aliases B | Official full name B | Experimental | Source | PubMed ID |
|---|---|---|---|---|---|
| CTTNBP2 | C7orf8 | CORTBP2 | FLJ34229 | KIAA1758 | MGC104579 | Orf4 | cortactin binding protein 2 | Affinity Capture-MS | BioGRID | 18782753 |
| FAM40A | FLJ14743 | KIAA1761 | MGC148091 | RP4-773N10.1 | family with sequence similarity 40, member A | Affinity Capture-MS Affinity Capture-Western | BioGRID | 18782753 |
| FAM40B | - | family with sequence similarity 40, member B | Affinity Capture-MS | BioGRID | 18782753 |
| MOBKL3 | 2C4D | CGI-95 | MGC12264 | MOB1 | MOB3 | PREI3 | MOB1, Mps One Binder kinase activator-like 3 (yeast) | Affinity Capture-MS Affinity Capture-Western | BioGRID | 18782753 |
| PDCD10 | CCM3 | MGC1212 | MGC24477 | TFAR15 | programmed cell death 10 | Affinity Capture-MS | BioGRID | 18782753 |
| PPP2CA | PP2Ac | PP2CA | RP-C | protein phosphatase 2 (formerly 2A), catalytic subunit, alpha isoform | Affinity Capture-MS | BioGRID | 18782753 |
| PPP2CB | PP2CB | protein phosphatase 2 (formerly 2A), catalytic subunit, beta isoform | Affinity Capture-MS | BioGRID | 18782753 |
| PPP2R1A | MGC786 | PR65A | protein phosphatase 2 (formerly 2A), regulatory subunit A, alpha isoform | Affinity Capture-MS Affinity Capture-Western | BioGRID | 18782753 |
| PPP2R1B | MGC26454 | PR65B | protein phosphatase 2 (formerly 2A), regulatory subunit A, beta isoform | Affinity Capture-MS | BioGRID | 18782753 |
| RP6-213H19.1 | MASK | MST4 | serine/threonine protein kinase MST4 | Affinity Capture-MS Affinity Capture-Western | BioGRID | 18782753 |
| STK24 | MST-3 | MST3 | MST3B | STE20 | STK3 | serine/threonine kinase 24 (STE20 homolog, yeast) | Affinity Capture-MS Affinity Capture-Western | BioGRID | 18782753 |
| STK25 | DKFZp686J1430 | SOK1 | YSK1 | serine/threonine kinase 25 (STE20 homolog, yeast) | Affinity Capture-MS | BioGRID | 18782753 |
| STRN | MGC125642 | SG2NA | striatin, calmodulin binding protein | Affinity Capture-MS Affinity Capture-Western | BioGRID | 18782753 |
| STRN3 | SG2NA | striatin, calmodulin binding protein 3 | Affinity Capture-MS Affinity Capture-Western | BioGRID | 18782753 |
| STRN4 | FLJ35594 | ZIN | zinedin | striatin, calmodulin binding protein 4 | Affinity Capture-MS | BioGRID | 18782753 |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| PICCALUGA ANGIOIMMUNOBLASTIC LYMPHOMA UP | 205 | 140 | All SZGR 2.0 genes in this pathway |
| LIU SOX4 TARGETS UP | 137 | 94 | All SZGR 2.0 genes in this pathway |
| MARTORIATI MDM4 TARGETS FETAL LIVER DN | 514 | 319 | All SZGR 2.0 genes in this pathway |
| DAIRKEE TERT TARGETS DN | 124 | 79 | All SZGR 2.0 genes in this pathway |
| RODWELL AGING KIDNEY NO BLOOD UP | 222 | 139 | All SZGR 2.0 genes in this pathway |
| CHEN METABOLIC SYNDROM NETWORK | 1210 | 725 | All SZGR 2.0 genes in this pathway |
| MILI PSEUDOPODIA HAPTOTAXIS UP | 518 | 299 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-1/206 | 27 | 34 | 1A,m8 | hsa-miR-1 | UGGAAUGUAAAGAAGUAUGUA |
| hsa-miR-206SZ | UGGAAUGUAAGGAAGUGUGUGG | ||||
| hsa-miR-613 | AGGAAUGUUCCUUCUUUGCC | ||||
| miR-137 | 877 | 884 | 1A,m8 | hsa-miR-137 | UAUUGCUUAAGAAUACGCGUAG |
| miR-181 | 480 | 486 | m8 | hsa-miR-181abrain | AACAUUCAACGCUGUCGGUGAGU |
| hsa-miR-181bSZ | AACAUUCAUUGCUGUCGGUGGG | ||||
| hsa-miR-181cbrain | AACAUUCAACCUGUCGGUGAGU | ||||
| hsa-miR-181dbrain | AACAUUCAUUGUUGUCGGUGGGUU | ||||
| miR-26 | 802 | 809 | 1A,m8 | hsa-miR-26abrain | UUCAAGUAAUCCAGGAUAGGC |
| hsa-miR-26bSZ | UUCAAGUAAUUCAGGAUAGGUU | ||||
| miR-544 | 335 | 341 | m8 | hsa-miR-544 | AUUCUGCAUUUUUAGCAAGU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.