SZGR2

Summary ?

GeneID	5592
Symbol	PRKG1
Synonyms	AAT8\|PKG\|PRKG1B\|PRKGR1B\|cGK\|cGK 1\|cGK1\|cGKI\|cGKI-BETA\|cGKI-alpha
Description	protein kinase, cGMP-dependent, type I
Reference	MIM:176894\|HGNC:HGNC:9414\|Ensembl:ENSG00000185532\|HPRD:08910\|Vega:OTTHUMG00000018248
Gene type	protein-coding
Map location	10q11.2
DMG	1 (# studies)
eGene	Caudate basal ganglia

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Jaffe_2016	Genome-wide DNA methylation analysis	This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05.	2
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias	Click to show details
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 3

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg11212172	10	53459438	PRKG1	1.16E-8	-0.013	4.82E-6	DMG:Jaffe_2016
cg00407729	10	52751144	PRKG1	2.25E-8	-0.011	7.53E-6	DMG:Jaffe_2016

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
AQP3	0.68	0.33
RIN1	0.64	0.65
FBXL8	0.61	0.54
CLEC4G	0.61	0.61
KCNG2	0.60	0.57
METTL7B	0.58	0.41
P2RX2	0.58	0.47
CNGB1	0.55	0.48
TRADD	0.55	0.51
PNCK	0.54	0.55

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
MLLT3	-0.28	-0.24
CBLB	-0.28	-0.26
C1orf26	-0.28	-0.26
ZNF286	-0.28	-0.24
DACT1	-0.28	-0.22
NFIL3	-0.28	-0.24
KCNRG	-0.28	-0.24
CEP170	-0.28	-0.23
KLF11	-0.28	-0.24
LRCH1	-0.28	-0.28

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0000166	nucleotide binding	IEA		-
GO:0005515	protein binding	IEA		-
GO:0005524	ATP binding	IEA		-
GO:0004674	protein serine/threonine kinase activity	IEA		-
GO:0004692	cGMP-dependent protein kinase activity	IEA		-
GO:0016740	transferase activity	IEA		-
GO:0008603	cAMP-dependent protein kinase regulator activity	IEA		-
GO:0030553	cGMP binding	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0001764	neuron migration	IEA	neuron (GO term level: 8)	-
GO:0030900	forebrain development	IEA	Brain (GO term level: 8)	-
GO:0016358	dendrite development	IEA	neurite, dendrite (GO term level: 11)	-
GO:0001932	regulation of protein amino acid phosphorylation	IEA		-
GO:0006468	protein amino acid phosphorylation	IEA		-
GO:0007165	signal transduction	IEA		-
GO:0007165	signal transduction	TAS		2792381
GO:0030036	actin cytoskeleton organization	TAS		10851246
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005794	Golgi apparatus	IEA		-
GO:0005634	nucleus	IDA		18029348
GO:0005730	nucleolus	IDA		18029348
GO:0005737	cytoplasm	IDA		18029348
GO:0005952	cAMP-dependent protein kinase complex	IEA		-

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG VASCULAR SMOOTH MUSCLE CONTRACTION	115	81	All SZGR 2.0 genes in this pathway
KEGG GAP JUNCTION	90	68	All SZGR 2.0 genes in this pathway
KEGG LONG TERM DEPRESSION	70	53	All SZGR 2.0 genes in this pathway
KEGG OLFACTORY TRANSDUCTION	389	85	All SZGR 2.0 genes in this pathway
BIOCARTA NO1 PATHWAY	33	24	All SZGR 2.0 genes in this pathway
PID P38 ALPHA BETA PATHWAY	31	25	All SZGR 2.0 genes in this pathway
PID TXA2PATHWAY	57	43	All SZGR 2.0 genes in this pathway
REACTOME CGMP EFFECTS	19	13	All SZGR 2.0 genes in this pathway
REACTOME NITRIC OXIDE STIMULATES GUANYLATE CYCLASE	25	19	All SZGR 2.0 genes in this pathway
REACTOME PLATELET HOMEOSTASIS	78	49	All SZGR 2.0 genes in this pathway
REACTOME RAP1 SIGNALLING	17	12	All SZGR 2.0 genes in this pathway
REACTOME HEMOSTASIS	466	331	All SZGR 2.0 genes in this pathway
REACTOME IMMUNE SYSTEM	933	616	All SZGR 2.0 genes in this pathway
REACTOME ADAPTIVE IMMUNE SYSTEM	539	350	All SZGR 2.0 genes in this pathway
RODRIGUES THYROID CARCINOMA ANAPLASTIC DN	537	339	All SZGR 2.0 genes in this pathway
GAUSSMANN MLL AF4 FUSION TARGETS G UP	238	135	All SZGR 2.0 genes in this pathway
GALLUZZI PREVENT MITOCHONDIAL PERMEABILIZATION	22	16	All SZGR 2.0 genes in this pathway
SCHLESINGER METHYLATED DE NOVO IN CANCER	88	64	All SZGR 2.0 genes in this pathway
FALVELLA SMOKERS WITH LUNG CANCER	80	52	All SZGR 2.0 genes in this pathway
BENPORATH SUZ12 TARGETS	1038	678	All SZGR 2.0 genes in this pathway
BENPORATH EED TARGETS	1062	725	All SZGR 2.0 genes in this pathway
BENPORATH ES WITH H3K27ME3	1118	744	All SZGR 2.0 genes in this pathway
BENPORATH PRC2 TARGETS	652	441	All SZGR 2.0 genes in this pathway
HOFMANN CELL LYMPHOMA DN	39	29	All SZGR 2.0 genes in this pathway
CUI TCF21 TARGETS 2 DN	830	547	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 24HR DN	148	102	All SZGR 2.0 genes in this pathway
WANG CISPLATIN RESPONSE AND XPC DN	228	146	All SZGR 2.0 genes in this pathway
IVANOVA HEMATOPOIESIS STEM CELL	254	164	All SZGR 2.0 genes in this pathway
RIZKI TUMOR INVASIVENESS 3D DN	270	181	All SZGR 2.0 genes in this pathway
FIRESTEIN PROLIFERATION	175	125	All SZGR 2.0 genes in this pathway
VANTVEER BREAST CANCER BRCA1 DN	44	28	All SZGR 2.0 genes in this pathway
MCMURRAY TP53 HRAS COOPERATION RESPONSE DN	67	46	All SZGR 2.0 genes in this pathway
MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3	1069	729	All SZGR 2.0 genes in this pathway
FONTAINE FOLLICULAR THYROID ADENOMA UP	75	43	All SZGR 2.0 genes in this pathway
FONTAINE PAPILLARY THYROID CARCINOMA UP	66	38	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-103/107	121	127	m8	hsa-miR-103^brain	AGCAGCAUUGUACAGGGCUAUGA
miR-103/107	121	127	m8	hsa-miR-107^brain	AGCAGCAUUGUACAGGGCUAUCA
miR-149	1039	1045	1A	hsa-miR-149^brain	UCUGGCUCCGUGUCUUCACUCC
miR-15/16/195/424/497	122	128	m8	hsa-miR-15a^brain	UAGCAGCACAUAAUGGUUUGUG
				hsa-miR-16^brain	UAGCAGCACGUAAAUAUUGGCG
				hsa-miR-15b^brain	UAGCAGCACAUCAUGGUUUACA
				hsa-miR-195^SZ	UAGCAGCACAGAAAUAUUGGC
				hsa-miR-424	CAGCAGCAAUUCAUGUUUUGAA
				hsa-miR-497	CAGCAGCACACUGUGGUUUGU
miR-203.1	775	781	1A	hsa-miR-203	UGAAAUGUUUAGGACCACUAG
miR-218	627	634	1A,m8	hsa-miR-218^brain	UUGUGCUUGAUCUAACCAUGU
miR-29	965	971	1A	hsa-miR-29a^SZ	UAGCACCAUCUGAAAUCGGUU
				hsa-miR-29b^SZ	UAGCACCAUUUGAAAUCAGUGUU
				hsa-miR-29c^SZ	UAGCACCAUUUGAAAUCGGU
miR-320	36	42	m8	hsa-miR-320	AAAAGCUGGGUUGAGAGGGCGAA
miR-330	281	287	m8	hsa-miR-330^brain	GCAAAGCACACGGCCUGCAGAGA
miR-365	143	149	1A	hsa-miR-365	UAAUGCCCCUAAAAAUCCUUAU
miR-539	4	10	m8	hsa-miR-539	GGAGAAAUUAUCCUUGGUGUGU

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: PRKG1