Summary ?
GeneID56141
SymbolPCDHA7
SynonymsCNR4|CNRN4|CNRS4|CRNR4|PCDH-ALPHA7
Descriptionprotocadherin alpha 7
ReferenceMIM:606313|HGNC:HGNC:8673|Ensembl:ENSG00000204963|HPRD:07325|Vega:OTTHUMG00000163371
Gene typeprotein-coding
Map location5q31
Pascal p-value5.218E-6
eGeneAnterior cingulate cortex BA24
Cortex
Putamen basal ganglia

Gene in Data Sources
Gene set name Method of gene setDescriptionInfo
CV:PGCnpGenome-wide Association StudyGWAS
GSMA_IGenome scan meta-analysisPsr: 0.0032 
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 1 

Section I. Genetics and epigenetics annotation

@eQTL annotation

SNP IDChromosomePositioneGeneGene Entrez IDpvalueqvalueTSS distanceeQTL type
rs2513645140237387PCDHA7ENSG00000204963.44.08621E-60.0523418gtex_brain_ba24
rs6301625140237548PCDHA7ENSG00000204963.44.07601E-60.0523579gtex_brain_ba24
rs37761145140350545PCDHA7ENSG00000204963.45.10305E-60.04136576gtex_brain_putamen_basal

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005509calcium ion bindingIEA-
GO:0005515protein bindingIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0007399nervous system developmentTASneurite (GO term level: 5)10380929 
GO:0007155cell adhesionTAS10380929 
GO:0007156homophilic cell adhesionIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005886plasma membraneIEA-
GO:0005887integral to plasma membraneTAS10380929 

Section V. Pathway annotation

Pathway namePathway size# SZGR 2.0 genes in pathwayInfo
MIKKELSEN IPS HCP WITH H3 UNMETHYLATED 8050All SZGR 2.0 genes in this pathway
MIKKELSEN MEF HCP WITH H3 UNMETHYLATED 228119All SZGR 2.0 genes in this pathway
MARTENS TRETINOIN RESPONSE UP 857456All SZGR 2.0 genes in this pathway
STAMBOLSKY BOUND BY MUTATED TP53 1812All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-124/50621942200m8hsa-miR-506UAAGGCACCCUUCUGAGUAGA
hsa-miR-124brainUAAGGCACGCGGUGAAUGCC
miR-15/16/195/424/497101510221A,m8hsa-miR-15abrainUAGCAGCACAUAAUGGUUUGUG
hsa-miR-16brainUAGCAGCACGUAAAUAUUGGCG
hsa-miR-15bbrainUAGCAGCACAUCAUGGUUUACA
hsa-miR-195SZUAGCAGCACAGAAAUAUUGGC
hsa-miR-424CAGCAGCAAUUCAUGUUUUGAA
hsa-miR-497CAGCAGCACACUGUGGUUUGU
miR-1538418471Ahsa-miR-153UUGCAUAGUCACAAAAGUGA
miR-17-5p/20/93.mr/106/519.d22592265m8hsa-miR-17-5pCAAAGUGCUUACAGUGCAGGUAGU
hsa-miR-20abrainUAAAGUGCUUAUAGUGCAGGUAG
hsa-miR-106aAAAAGUGCUUACAGUGCAGGUAGC
hsa-miR-106bSZUAAAGUGCUGACAGUGCAGAU
hsa-miR-20bSZCAAAGUGCUCAUAGUGCAGGUAG
hsa-miR-519dCAAAGUGCCUCCCUUUAGAGUGU
hsa-miR-17-5pCAAAGUGCUUACAGUGCAGGUAGU
hsa-miR-20abrainUAAAGUGCUUAUAGUGCAGGUAG
hsa-miR-106aAAAAGUGCUUACAGUGCAGGUAGC
hsa-miR-106bSZUAAAGUGCUGACAGUGCAGAU
hsa-miR-20bSZCAAAGUGCUCAUAGUGCAGGUAG
hsa-miR-519dCAAAGUGCCUCCCUUUAGAGUGU
miR-181152315301A,m8hsa-miR-181abrainAACAUUCAACGCUGUCGGUGAGU
hsa-miR-181bSZAACAUUCAUUGCUGUCGGUGGG
hsa-miR-181cbrainAACAUUCAACCUGUCGGUGAGU
hsa-miR-181dbrainAACAUUCAUUGUUGUCGGUGGGUU
miR-1855258m8hsa-miR-185brainUGGAGAGAAAGGCAGUUC
hsa-miR-185brainUGGAGAGAAAGGCAGUUC
miR-186791797m8hsa-miR-186CAAAGAAUUCUCCUUUUGGGCUU
miR-197968031A,m8hsa-miR-19aUGUGCAAAUCUAUGCAAAACUGA
hsa-miR-19bUGUGCAAAUCCAUGCAAAACUGA
miR-218179117981A,m8hsa-miR-218brainUUGUGCUUGAUCUAACCAUGU
miR-221/22260671A,m8hsa-miR-221brainAGCUACAUUGUCUGCUGGGUUUC
hsa-miR-222brainAGCUACAUCUGGCUACUGGGUCUC
miR-23212521311Ahsa-miR-23abrainAUCACAUUGCCAGGGAUUUCC
hsa-miR-23bbrainAUCACAUUGCCAGGGAUUACC
hsa-miR-23abrainAUCACAUUGCCAGGGAUUUCC
hsa-miR-23bbrainAUCACAUUGCCAGGGAUUACC
miR-29235523621A,m8hsa-miR-29aSZUAGCACCAUCUGAAAUCGGUU
hsa-miR-29bSZUAGCACCAUUUGAAAUCAGUGUU
hsa-miR-29cSZUAGCACCAUUUGAAAUCGGU
miR-320151215181Ahsa-miR-320AAAAGCUGGGUUGAGAGGGCGAA
hsa-miR-320AAAAGCUGGGUUGAGAGGGCGAA
hsa-miR-320AAAAGCUGGGUUGAGAGGGCGAA
miR-329207120781A,m8hsa-miR-329brainAACACACCUGGUUAACCUCUUU
miR-330183318401A,m8hsa-miR-330brainGCAAAGCACACGGCCUGCAGAGA
miR-362232023261Ahsa-miR-362AAUCCUUGGAACCUAGGUGUGAGU
miR-369-3p105710641A,m8hsa-miR-369-3pAAUAAUACAUGGUUGAUCUUU
miR-4488418471Ahsa-miR-448UUGCAUAUGUAGGAUGUCCCAU
miR-495883889m8hsa-miR-495brainAAACAAACAUGGUGCACUUCUUU
miR-503101610221Ahsa-miR-503UAGCAGCGGGAACAGUUCUGCAG
miR-505152015261Ahsa-miR-505GUCAACACUUGCUGGUUUCCUC
miR-539125712631Ahsa-miR-539GGAGAAAUUAUCCUUGGUGUGU
miR-93.hd/291-3p/294/295/302/372/373/52022582264m8hsa-miR-93brainAAAGUGCUGUUCGUGCAGGUAG
hsa-miR-302aUAAGUGCUUCCAUGUUUUGGUGA
hsa-miR-302bUAAGUGCUUCCAUGUUUUAGUAG
hsa-miR-302cUAAGUGCUUCCAUGUUUCAGUGG
hsa-miR-302dUAAGUGCUUCCAUGUUUGAGUGU
hsa-miR-372AAAGUGCUGCGACAUUUGAGCGU
hsa-miR-373GAAGUGCUUCGAUUUUGGGGUGU
hsa-miR-520eAAAGUGCUUCCUUUUUGAGGG
hsa-miR-520aAAAGUGCUUCCCUUUGGACUGU
hsa-miR-520bAAAGUGCUUCCUUUUAGAGGG
hsa-miR-520cAAAGUGCUUCCUUUUAGAGGGUU
hsa-miR-520dAAAGUGCUUCUCUUUGGUGGGUU