SZGR2

Summary ?

GeneID	5663
Symbol	PSEN1
Synonyms	AD3\|FAD\|PS-1\|PS1\|S182
Description	presenilin 1
Reference	MIM:104311\|HGNC:HGNC:9508\|Ensembl:ENSG00000080815\|HPRD:00087\|Vega:OTTHUMG00000141279
Gene type	protein-coding
Map location	14q24.3
Pascal p-value	0.118
Sherlock p-value	0.138
Fetal beta	0.388
eGene	Myers' cis & trans
Support	NEUROTROPHIN SIGNALING

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias	Click to show details
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 7
Network	Shortest path distance of core genes in the Human protein-protein interaction network	Contribution to shortest path in PPI network: 0.1281

Section I. Genetics and epigenetics annotation

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	pvalue	qvalue	TSS distance	eQTL type
rs16869851	chr4	20690056	PSEN1	5663		0.06		trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
PSMA7	0.94	0.94
EIF6	0.93	0.94
C17orf49	0.92	0.93
RPL26L1	0.92	0.94
PQBP1	0.92	0.93
SEC61B	0.91	0.89
PSMD13	0.91	0.93
CCT7	0.90	0.90
NDUFB11	0.90	0.90
SNRPC	0.90	0.91

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
AF347015.33	-0.72	-0.80
AF347015.26	-0.71	-0.84
AF347015.8	-0.71	-0.79
MT-CO2	-0.71	-0.76
MT-CYB	-0.71	-0.79
AF347015.15	-0.71	-0.81
AF347015.27	-0.71	-0.79
AF347015.2	-0.70	-0.81
AF347015.31	-0.68	-0.75
TINAGL1	-0.66	-0.76

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0004175	endopeptidase activity	IDA		8755489
GO:0008013	beta-catenin binding	IPI		11104755
GO:0008233	peptidase activity	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0001764	neuron migration	IEA	neuron (GO term level: 8)	-
GO:0048167	regulation of synaptic plasticity	IEA	Synap (GO term level: 8)	-
GO:0030900	forebrain development	IEA	Brain (GO term level: 8)	-
GO:0048854	brain morphogenesis	IEA	Brain (GO term level: 8)	-
GO:0001756	somitogenesis	IEA		-
GO:0001568	blood vessel development	IEA		-
GO:0001708	cell fate specification	IEA		-
GO:0002244	hemopoietic progenitor cell differentiation	IEA		-
GO:0002573	myeloid leukocyte differentiation	IEA		-
GO:0002286	T cell activation during immune response	IEA		-
GO:0001933	negative regulation of protein amino acid phosphorylation	IEA		-
GO:0001947	heart looping	IEA		-
GO:0042987	amyloid precursor protein catabolic process	TAS		15274632
GO:0007176	regulation of epidermal growth factor receptor activity	IEA		-
GO:0006486	protein amino acid glycosylation	IEA		-
GO:0006509	membrane protein ectodomain proteolysis	IDA		15274632
GO:0007242	intracellular signaling cascade	IEA		-
GO:0007220	Notch receptor processing	TAS		15274632
GO:0009790	embryonic development	IEA		-
GO:0009791	post-embryonic development	IEA		-
GO:0007507	heart development	IEA		-
GO:0007613	memory	IEA		-
GO:0006916	anti-apoptosis	TAS		10805794
GO:0007059	chromosome segregation	TAS		10206644
GO:0043065	positive regulation of apoptosis	IEA		-
GO:0016337	cell-cell adhesion	IMP		11953314
GO:0042325	regulation of phosphorylation	IDA		9689133
GO:0016485	protein processing	IDA		15274632
GO:0040011	locomotion	IEA		-
GO:0021904	dorsoventral neural tube patterning	IEA		-
GO:0050820	positive regulation of coagulation	IEA		-
GO:0050852	T cell receptor signaling pathway	IEA		-
GO:0043085	positive regulation of catalytic activity	IDA		15274632
GO:0030326	embryonic limb morphogenesis	IEA		-
GO:0042640	anagen	IEA		-
GO:0045860	positive regulation of protein kinase activity	IEA		-
GO:0048538	thymus development	IEA		-
GO:0050435	beta-amyloid metabolic process	IEA		-
GO:0051563	smooth endoplasmic reticulum calcium ion homeostasis	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0043025	cell soma	IEA	axon, dendrite (GO term level: 4)	-
GO:0030425	dendrite	IEA	neuron, axon, dendrite (GO term level: 6)	-
GO:0030424	axon	IEA	neuron, axon, Neurotransmitter (GO term level: 6)	-
GO:0000139	Golgi membrane	IEA		-
GO:0000776	kinetochore	TAS		9298903
GO:0005794	Golgi apparatus	IDA		15274632
GO:0005789	endoplasmic reticulum membrane	IEA		-
GO:0005622	intracellular	IEA		-
GO:0005624	membrane fraction	TAS		8878479
GO:0005634	nucleus	IEA		-
GO:0005639	integral to nuclear inner membrane	TAS		9298903
GO:0005640	nuclear outer membrane	IDA		9246482
GO:0005739	mitochondrion	IDA		12377771
GO:0005783	endoplasmic reticulum	IDA		15274632
GO:0009986	cell surface	IEA		-
GO:0005886	plasma membrane	IEA		-
GO:0005887	integral to plasma membrane	IDA		15274632
GO:0035253	ciliary rootlet	IEA		-
GO:0031410	cytoplasmic vesicle	IEA		-

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
APBA1	D9S411E \| MINT1 \| X11 \| X11A \| X11ALPHA	amyloid beta (A4) precursor protein-binding, family A, member 1	-	HPRD	12196555
APH1A	6530402N02Rik \| APH-1A \| CGI-78	anterior pharynx defective 1 homolog A (C. elegans)	APH-1A interacts with PSEN1.	BIND	12297508
APH1A	6530402N02Rik \| APH-1A \| CGI-78	anterior pharynx defective 1 homolog A (C. elegans)	Affinity Capture-Western Co-fractionation	BioGRID	12297508 \|12471034 \|14572442
APH1B	APH-1B \| DKFZp564D0372 \| PRO1328 \| PSFL \| TAAV688	anterior pharynx defective 1 homolog B (C. elegans)	-	HPRD	12471034
APP	AAA \| ABETA \| ABPP \| AD1 \| APPI \| CTFgamma \| CVAP \| PN2	amyloid beta (A4) precursor protein	-	HPRD	10593990
APP	AAA \| ABETA \| ABPP \| AD1 \| APPI \| CTFgamma \| CVAP \| PN2	amyloid beta (A4) precursor protein	APPswe interacts with PS-1delta-9.	BIND	14756819
APP	AAA \| ABETA \| ABPP \| AD1 \| APPI \| CTFgamma \| CVAP \| PN2	amyloid beta (A4) precursor protein	PS1 interacts with APP via the APP-C100 fragment.	BIND	10801777
APP	AAA \| ABETA \| ABPP \| AD1 \| APPI \| CTFgamma \| CVAP \| PN2	amyloid beta (A4) precursor protein	PS1 interacts with APP751.	BIND	9223340
APP	AAA \| ABETA \| ABPP \| AD1 \| APPI \| CTFgamma \| CVAP \| PN2	amyloid beta (A4) precursor protein	PS1 interacts with APP695.	BIND	9223340
APP	AAA \| ABETA \| ABPP \| AD1 \| APPI \| CTFgamma \| CVAP \| PN2	amyloid beta (A4) precursor protein	PS1 interacts with APP.	BIND	15448688
BCL2	Bcl-2	B-cell CLL/lymphoma 2	-	HPRD,BioGRID	10521466
BCL2L1	BCL-XL/S \| BCL2L \| BCLX \| Bcl-X \| DKFZp781P2092 \| bcl-xL \| bcl-xS	BCL2-like 1	-	HPRD,BioGRID	10446169
CASP1	ICE \| IL1BC \| P45	caspase 1, apoptosis-related cysteine peptidase (interleukin 1, beta, convertase)	PS-1 interacts with caspase 1. This interaction was modeled on a demonstrated interaction between human PS1 and mouse caspase 1.	BIND	10069390
CASP3	CPP32 \| CPP32B \| SCA-1	caspase 3, apoptosis-related cysteine peptidase	PS1 interacts with caspase 3. This interaction was modeled on a demonstrated interaction between human PS1 and mouse caspase 3.	BIND	10069390
CASP4	ICE(rel)II \| ICEREL-II \| ICH-2 \| Mih1/TX \| TX	caspase 4, apoptosis-related cysteine peptidase	PS1 interacts with caspase 4. This interaction was modeled on a demonstrated interaction between human PS1 and mouse caspase 4.	BIND	10069390
CASP7	CMH-1 \| ICE-LAP3 \| MCH3	caspase 7, apoptosis-related cysteine peptidase	PS1 interacts with caspase 7. This interaction was modeled on a demonstrated interaction between human PS1 and mouse caspase 7.	BIND	10069390
CDH1	Arc-1 \| CD324 \| CDHE \| ECAD \| LCAM \| UVO	cadherin 1, type 1, E-cadherin (epithelial)	Affinity Capture-Western	BioGRID	10635315
CIB1	CIB \| KIP \| KIP1 \| SIP2-28	calcium and integrin binding 1 (calmyrin)	Two-hybrid	BioGRID	10366599
CLSTN1	ALC-ALPHA \| CSTN1 \| FLJ32258 \| KIAA0911 \| PIK3CD \| XB31alpha \| alcalpha1 \| alcalpha2	calsyntenin 1	Affinity Capture-Western	BioGRID	15037614
CTNNA1	CAP102 \| FLJ36832	catenin (cadherin-associated protein), alpha 1, 102kDa	Affinity Capture-Western	BioGRID	10635315
CTNNB1	CTNNB \| DKFZp686D02253 \| FLJ25606 \| FLJ37923	catenin (cadherin-associated protein), beta 1, 88kDa	Affinity Capture-Western	BioGRID	9738936 \|9852041 \|10341227
CTNNB1	CTNNB \| DKFZp686D02253 \| FLJ25606 \| FLJ37923	catenin (cadherin-associated protein), beta 1, 88kDa	PS1 interacts with beta-catenin.	BIND	9632714
CTNND1	CAS \| CTNND \| KIAA0384 \| P120CAS \| P120CTN \| p120	catenin (cadherin-associated protein), delta 1	Affinity Capture-Western Reconstituted Complex Two-hybrid	BioGRID	10208590
CTNND2	GT24 \| NPRAP	catenin (cadherin-associated protein), delta 2 (neural plakophilin-related arm-repeat protein)	PS1 interacts with NPRAP	BIND	10037471
DOCK3	KIAA0299 \| MOCA \| PBP	dedicator of cytokinesis 3	-	HPRD	10854253
ERN1	FLJ30999 \| IRE1 \| IRE1P \| MGC163277 \| MGC163279	endoplasmic reticulum to nucleus signaling 1	-	HPRD,BioGRID	10587643
FBXW7	AGO \| CDC4 \| DKFZp686F23254 \| FBW6 \| FBW7 \| FBX30 \| FBXO30 \| FBXW6 \| FLJ16457 \| SEL-10 \| SEL10	F-box and WD repeat domain containing 7	Affinity Capture-Western	BioGRID	12354302
FLNB	ABP-278 \| AOI \| DKFZp686A1668 \| DKFZp686O033 \| FH1 \| FLN1L \| LRS1 \| SCT \| TABP \| TAP	filamin B, beta (actin binding protein 278)	Reconstituted Complex Two-hybrid	BioGRID	9437013
GFAP	FLJ45472	glial fibrillary acidic protein	-	HPRD,BioGRID	12058025
HERPUD1	HERP \| KIAA0025 \| Mif1 \| SUP	homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1	-	HPRD,BioGRID	11799129
ICAM5	TLCN \| TLN	intercellular adhesion molecule 5, telencephalin	-	HPRD,BioGRID	11719200
KCNIP3	CSEN \| DREAM \| KCHIP3 \| MGC18289	Kv channel interacting protein 3, calsenilin	Affinity Capture-Western	BioGRID	9771752 \|10854253
KCNIP3	CSEN \| DREAM \| KCHIP3 \| MGC18289	Kv channel interacting protein 3, calsenilin	-	HPRD	12207970
KCNIP4	CALP \| KCHIP4 \| MGC44947	Kv channel interacting protein 4	Two-hybrid	BioGRID	11847232
MAPT	DDPAC \| FLJ31424 \| FTDP-17 \| MAPTL \| MGC138549 \| MSTD \| MTBT1 \| MTBT2 \| PPND \| TAU	microtubule-associated protein tau	-	HPRD,BioGRID	9689133
METTL2B	FLJ11350 \| FLJ12760 \| METL \| METTL2 \| METTL2A \| PSENIP1	methyltransferase like 2B	Two-hybrid	BioGRID	11738826
MTCH1	CGI-64 \| MGC131998 \| PIG60 \| PSAP	mitochondrial carrier homolog 1 (C. elegans)	-	HPRD	10551805
NCSTN	APH2 \| KIAA0253	nicastrin	PS1 interacts with Nicastrin.	BIND	10993067
NCSTN	APH2 \| KIAA0253	nicastrin	Affinity Capture-Western	BioGRID	10993067 \|12297508 \|12471034 \|14572442 \|15257293
NOTCH1	TAN1 \| hN1	Notch homolog 1, translocation-associated (Drosophila)	Affinity Capture-Western	BioGRID	10077672
PKP4	FLJ31261 \| FLJ42243 \| p0071	plakophilin 4	-	HPRD,BioGRID	10037471 \|10092585
PSEN1	AD3 \| FAD \| PS1 \| S182	presenilin 1	Two-hybrid	BioGRID	12535650
PSEN2	AD3L \| AD4 \| PS2 \| STM2	presenilin 2 (Alzheimer disease 4)	Affinity Capture-Western	BioGRID	12471034
PSENEN	MDS033 \| MSTP064 \| PEN-2 \| PEN2	presenilin enhancer 2 homolog (C. elegans)	PEN-2 interacts with PS1.	BIND	15322109
PSENEN	MDS033 \| MSTP064 \| PEN-2 \| PEN2	presenilin enhancer 2 homolog (C. elegans)	-	HPRD,BioGRID	12198112 \|12639958
STX1A	HPC-1 \| STX1 \| p35-1	syntaxin 1A (brain)	PS1 interacts with syntaxin 1A.	BIND	10891589
STX5	SED5 \| STX5A	syntaxin 5	The full-length PS1 holoprotein interacts with Syntaxin 5.	BIND	15109302
TCF7L2	TCF-4 \| TCF4	transcription factor 7-like 2 (T-cell specific, HMG-box)	-	HPRD,BioGRID	11504726
UBQLN1	DA41 \| DSK2 \| FLJ90054 \| PLIC-1 \| XDRP1	ubiquilin 1	Reconstituted Complex Two-hybrid	BioGRID	11076969
YME1L1	FTSH \| MEG4 \| PAMP \| YME1L	YME1-like 1 (S. cerevisiae)	-	HPRD,BioGRID	12214059

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG WNT SIGNALING PATHWAY	151	112	All SZGR 2.0 genes in this pathway
KEGG NOTCH SIGNALING PATHWAY	47	35	All SZGR 2.0 genes in this pathway
KEGG NEUROTROPHIN SIGNALING PATHWAY	126	103	All SZGR 2.0 genes in this pathway
KEGG ALZHEIMERS DISEASE	169	110	All SZGR 2.0 genes in this pathway
BIOCARTA HIVNEF PATHWAY	58	43	All SZGR 2.0 genes in this pathway
BIOCARTA PS1 PATHWAY	14	14	All SZGR 2.0 genes in this pathway
ST WNT BETA CATENIN PATHWAY	34	28	All SZGR 2.0 genes in this pathway
PID NOTCH PATHWAY	59	49	All SZGR 2.0 genes in this pathway
PID PS1 PATHWAY	46	39	All SZGR 2.0 genes in this pathway
PID P75 NTR PATHWAY	69	51	All SZGR 2.0 genes in this pathway
PID SYNDECAN 3 PATHWAY	17	15	All SZGR 2.0 genes in this pathway
REACTOME SIGNALLING BY NGF	217	167	All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY ERBB4	90	67	All SZGR 2.0 genes in this pathway
REACTOME NUCLEAR SIGNALING BY ERBB4	38	30	All SZGR 2.0 genes in this pathway
REACTOME ACTIVATED NOTCH1 TRANSMITS SIGNAL TO THE NUCLEUS	27	18	All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY NOTCH4	12	10	All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY NOTCH2	12	10	All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY NOTCH1	70	46	All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY NOTCH3	12	10	All SZGR 2.0 genes in this pathway
REACTOME REGULATED PROTEOLYSIS OF P75NTR	10	9	All SZGR 2.0 genes in this pathway
REACTOME NRIF SIGNALS CELL DEATH FROM THE NUCLEUS	15	10	All SZGR 2.0 genes in this pathway
REACTOME CELL DEATH SIGNALLING VIA NRAGE NRIF AND NADE	60	43	All SZGR 2.0 genes in this pathway
REACTOME P75 NTR RECEPTOR MEDIATED SIGNALLING	81	61	All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY NOTCH	103	64	All SZGR 2.0 genes in this pathway
MULLIGHAN MLL SIGNATURE 1 UP	380	236	All SZGR 2.0 genes in this pathway
MULLIGHAN MLL SIGNATURE 2 UP	418	263	All SZGR 2.0 genes in this pathway
ODONNELL TFRC TARGETS UP	456	228	All SZGR 2.0 genes in this pathway
MISSIAGLIA REGULATED BY METHYLATION UP	126	78	All SZGR 2.0 genes in this pathway
BUYTAERT PHOTODYNAMIC THERAPY STRESS UP	811	508	All SZGR 2.0 genes in this pathway
BENPORATH CYCLING GENES	648	385	All SZGR 2.0 genes in this pathway
SHIN B CELL LYMPHOMA CLUSTER 8	36	28	All SZGR 2.0 genes in this pathway
ZHANG RESPONSE TO IKK INHIBITOR AND TNF UP	223	140	All SZGR 2.0 genes in this pathway
ASTON MAJOR DEPRESSIVE DISORDER DN	160	110	All SZGR 2.0 genes in this pathway
ZHANG TARGETS OF EWSR1 FLI1 FUSION	88	68	All SZGR 2.0 genes in this pathway
ALCALAY AML BY NPM1 LOCALIZATION UP	140	83	All SZGR 2.0 genes in this pathway
LENAOUR DENDRITIC CELL MATURATION DN	128	90	All SZGR 2.0 genes in this pathway
AFFAR YY1 TARGETS DN	234	137	All SZGR 2.0 genes in this pathway
ABRAHAM ALPC VS MULTIPLE MYELOMA DN	19	14	All SZGR 2.0 genes in this pathway
WANG CISPLATIN RESPONSE AND XPC DN	228	146	All SZGR 2.0 genes in this pathway
CREIGHTON ENDOCRINE THERAPY RESISTANCE 5	482	296	All SZGR 2.0 genes in this pathway
MARSON BOUND BY FOXP3 STIMULATED	1022	619	All SZGR 2.0 genes in this pathway
MARSON BOUND BY FOXP3 UNSTIMULATED	1229	713	All SZGR 2.0 genes in this pathway
MASSARWEH TAMOXIFEN RESISTANCE UP	578	341	All SZGR 2.0 genes in this pathway
IWANAGA CARCINOGENESIS BY KRAS PTEN DN	353	226	All SZGR 2.0 genes in this pathway
MCCABE BOUND BY HOXC6	469	239	All SZGR 2.0 genes in this pathway
MCCABE HOXC6 TARGETS CANCER DN	20	12	All SZGR 2.0 genes in this pathway
BLUM RESPONSE TO SALIRASIB UP	245	159	All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS UP	1305	895	All SZGR 2.0 genes in this pathway
SWEET LUNG CANCER KRAS UP	491	316	All SZGR 2.0 genes in this pathway
SWEET KRAS ONCOGENIC SIGNATURE	89	56	All SZGR 2.0 genes in this pathway
HSIAO HOUSEKEEPING GENES	389	245	All SZGR 2.0 genes in this pathway
MILI PSEUDOPODIA HAPTOTAXIS DN	668	419	All SZGR 2.0 genes in this pathway
KYNG WERNER SYNDROM AND NORMAL AGING DN	225	124	All SZGR 2.0 genes in this pathway
WHITFIELD CELL CYCLE M G1	148	95	All SZGR 2.0 genes in this pathway
RAO BOUND BY SALL4 ISOFORM A	182	108	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-9	1069	1075	1A	hsa-miR-9^SZ	UCUUUGGUUAUCUAGCUGUAUGA

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: PSEN1