Gene Page: SAR1A
Summary ?
GeneID | 56681 |
Symbol | SAR1A |
Synonyms | SAR1|SARA1|Sara|masra2 |
Description | secretion associated Ras related GTPase 1A |
Reference | MIM:607691|HGNC:HGNC:10534|Ensembl:ENSG00000079332|HPRD:07608|Vega:OTTHUMG00000018400 |
Gene type | protein-coding |
Map location | 10q22.1 |
Pascal p-value | 0.222 |
Sherlock p-value | 0.883 |
DMG | 1 (# studies) |
eGene | Putamen basal ganglia Myers' cis & trans |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Nishioka_2013 | Genome-wide DNA methylation analysis | The authors investigated the methylation profiles of DNA in peripheral blood cells from 18 patients with first-episode schizophrenia (FESZ) and from 15 normal controls. | 1 |
Network | Shortest path distance of core genes in the Human protein-protein interaction network | Contribution to shortest path in PPI network: 0.0951 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg11985856 | 10 | 71929891 | SAR1A | -0.025 | 0.95 | DMG:Nishioka_2013 |
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs4491879 | chr3 | 189373908 | SAR1A | 56681 | 0.08 | trans | ||
rs4505678 | chr3 | 189374356 | SAR1A | 56681 | 0.18 | trans | ||
rs2763364 | 10 | 71648800 | SAR1A | ENSG00000079332.10 | 9.8805E-7 | 0.04 | 281479 | gtex_brain_putamen_basal |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0000166 | nucleotide binding | IEA | - | |
GO:0003924 | GTPase activity | NAS | - | |
GO:0005525 | GTP binding | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0007264 | small GTPase mediated signal transduction | IEA | - | |
GO:0006886 | intracellular protein transport | IEA | - | |
GO:0006888 | ER to Golgi vesicle-mediated transport | NAS | - | |
GO:0016192 | vesicle-mediated transport | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005794 | Golgi apparatus | IEA | - | |
GO:0005622 | intracellular | IEA | - | |
GO:0005737 | cytoplasm | NAS | - | |
GO:0016529 | sarcoplasmic reticulum | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
HORIUCHI WTAP TARGETS UP | 306 | 188 | All SZGR 2.0 genes in this pathway |
WANG LMO4 TARGETS DN | 352 | 225 | All SZGR 2.0 genes in this pathway |
BARRIER COLON CANCER RECURRENCE UP | 42 | 28 | All SZGR 2.0 genes in this pathway |
TIEN INTESTINE PROBIOTICS 24HR UP | 557 | 331 | All SZGR 2.0 genes in this pathway |
RODRIGUES THYROID CARCINOMA POORLY DIFFERENTIATED UP | 633 | 376 | All SZGR 2.0 genes in this pathway |
PROVENZANI METASTASIS UP | 194 | 112 | All SZGR 2.0 genes in this pathway |
DARWICHE SKIN TUMOR PROMOTER DN | 185 | 115 | All SZGR 2.0 genes in this pathway |
DARWICHE PAPILLOMA RISK LOW UP | 162 | 104 | All SZGR 2.0 genes in this pathway |
DARWICHE PAPILLOMA RISK HIGH DN | 180 | 110 | All SZGR 2.0 genes in this pathway |
DARWICHE SQUAMOUS CELL CARCINOMA DN | 181 | 107 | All SZGR 2.0 genes in this pathway |
HEIDENBLAD AMPLICON 12P11 12 UP | 33 | 17 | All SZGR 2.0 genes in this pathway |
HEIDENBLAD AMPLICON 12P11 12 DN | 30 | 16 | All SZGR 2.0 genes in this pathway |
PUJANA CHEK2 PCC NETWORK | 779 | 480 | All SZGR 2.0 genes in this pathway |
NUYTTEN NIPP1 TARGETS UP | 769 | 437 | All SZGR 2.0 genes in this pathway |
NUYTTEN EZH2 TARGETS UP | 1037 | 673 | All SZGR 2.0 genes in this pathway |
WEI MIR34A TARGETS | 148 | 97 | All SZGR 2.0 genes in this pathway |
RICKMAN TUMOR DIFFERENTIATED WELL VS POORLY DN | 382 | 224 | All SZGR 2.0 genes in this pathway |
BASSO B LYMPHOCYTE NETWORK | 143 | 96 | All SZGR 2.0 genes in this pathway |
NING CHRONIC OBSTRUCTIVE PULMONARY DISEASE UP | 157 | 105 | All SZGR 2.0 genes in this pathway |
PENG GLUTAMINE DEPRIVATION DN | 337 | 230 | All SZGR 2.0 genes in this pathway |
ZHU CMV ALL UP | 120 | 89 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 18HR UP | 178 | 111 | All SZGR 2.0 genes in this pathway |
ZHU CMV 24 HR UP | 93 | 65 | All SZGR 2.0 genes in this pathway |
CREIGHTON ENDOCRINE THERAPY RESISTANCE 3 | 720 | 440 | All SZGR 2.0 genes in this pathway |
PELLICCIOTTA HDAC IN ANTIGEN PRESENTATION UP | 64 | 40 | All SZGR 2.0 genes in this pathway |
GAVIN FOXP3 TARGETS CLUSTER T7 | 98 | 63 | All SZGR 2.0 genes in this pathway |
MARTINEZ RB1 TARGETS UP | 673 | 430 | All SZGR 2.0 genes in this pathway |
MARTINEZ TP53 TARGETS UP | 602 | 364 | All SZGR 2.0 genes in this pathway |
MARTINEZ RB1 AND TP53 TARGETS UP | 601 | 369 | All SZGR 2.0 genes in this pathway |
ACEVEDO NORMAL TISSUE ADJACENT TO LIVER TUMOR UP | 174 | 96 | All SZGR 2.0 genes in this pathway |
ACEVEDO LIVER CANCER UP | 973 | 570 | All SZGR 2.0 genes in this pathway |
CHANG CORE SERUM RESPONSE UP | 212 | 128 | All SZGR 2.0 genes in this pathway |
SHEDDEN LUNG CANCER POOR SURVIVAL A6 | 456 | 285 | All SZGR 2.0 genes in this pathway |
YAGI AML WITH INV 16 TRANSLOCATION | 422 | 277 | All SZGR 2.0 genes in this pathway |
VERHAAK GLIOBLASTOMA NEURAL | 129 | 85 | All SZGR 2.0 genes in this pathway |
JOHNSTONE PARVB TARGETS 3 DN | 918 | 550 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-18 | 821 | 827 | m8 | hsa-miR-18a | UAAGGUGCAUCUAGUGCAGAUA |
hsa-miR-18b | UAAGGUGCAUCUAGUGCAGUUA | ||||
miR-34/449 | 1643 | 1650 | 1A,m8 | hsa-miR-34abrain | UGGCAGUGUCUUAGCUGGUUGUU |
hsa-miR-34c | AGGCAGUGUAGUUAGCUGAUUGC | ||||
hsa-miR-449 | UGGCAGUGUAUUGUUAGCUGGU | ||||
hsa-miR-449b | AGGCAGUGUAUUGUUAGCUGGC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.