Gene Page: CELF4
Summary ?
| GeneID | 56853 |
| Symbol | CELF4 |
| Synonyms | BRUNOL4|CELF-4 |
| Description | CUGBP, Elav-like family member 4 |
| Reference | MIM:612679|HGNC:HGNC:14015|Ensembl:ENSG00000101489|HPRD:12534|Vega:OTTHUMG00000178178 |
| Gene type | protein-coding |
| Map location | 18q12 |
| Pascal p-value | 0.183 |
| Sherlock p-value | 0.13 |
| Fetal beta | -1.535 |
| DMG | 1 (# studies) |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:GWAScat | Genome-wide Association Studies | This data set includes 560 SNPs associated with schizophrenia. A total of 486 genes were mapped to these SNPs within 50kb. | |
| CV:GWASdb | Genome-wide Association Studies | GWASdb records for schizophrenia | |
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DMG:Jaffe_2016 | Genome-wide DNA methylation analysis | This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. | 1 |
| PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
| Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
| Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
|---|---|---|---|---|---|---|---|
| cg00590960 | 18 | 35146726 | CELF4 | 6E-9 | -0.016 | 3.2E-6 | DMG:Jaffe_2016 |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0000166 | nucleotide binding | IEA | - | |
| GO:0000900 | translation repressor activity, nucleic acid binding | NAS | 10893231 | |
| GO:0003676 | nucleic acid binding | IEA | - | |
| GO:0042835 | BRE binding | ISS | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0007281 | germ cell development | NAS | 10893231 | |
| GO:0009790 | embryonic development | NAS | 10893231 | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005634 | nucleus | IEA | - | |
| GO:0005737 | cytoplasm | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| GRAESSMANN APOPTOSIS BY DOXORUBICIN UP | 1142 | 669 | All SZGR 2.0 genes in this pathway |
| GRAESSMANN RESPONSE TO MC AND DOXORUBICIN UP | 612 | 367 | All SZGR 2.0 genes in this pathway |
| GAUSSMANN MLL AF4 FUSION TARGETS G UP | 238 | 135 | All SZGR 2.0 genes in this pathway |
| AFFAR YY1 TARGETS UP | 214 | 133 | All SZGR 2.0 genes in this pathway |
| CUI TCF21 TARGETS 2 UP | 428 | 266 | All SZGR 2.0 genes in this pathway |
| MARTINEZ RB1 TARGETS DN | 543 | 317 | All SZGR 2.0 genes in this pathway |
| MARTINEZ TP53 TARGETS DN | 593 | 372 | All SZGR 2.0 genes in this pathway |
| MARTINEZ RB1 AND TP53 TARGETS DN | 591 | 366 | All SZGR 2.0 genes in this pathway |
| MEISSNER NPC HCP WITH H3K4ME2 | 491 | 319 | All SZGR 2.0 genes in this pathway |
| MIKKELSEN MCV6 HCP WITH H3K27ME3 | 435 | 318 | All SZGR 2.0 genes in this pathway |
| MIKKELSEN MEF HCP WITH H3K27ME3 | 590 | 403 | All SZGR 2.0 genes in this pathway |
| MARTENS TRETINOIN RESPONSE UP | 857 | 456 | All SZGR 2.0 genes in this pathway |
| FORTSCHEGGER PHF8 TARGETS DN | 784 | 464 | All SZGR 2.0 genes in this pathway |
| FOSTER KDM1A TARGETS DN | 211 | 119 | All SZGR 2.0 genes in this pathway |
| ZWANG TRANSIENTLY UP BY 2ND EGF PULSE ONLY | 1725 | 838 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-129-5p | 659 | 665 | 1A | hsa-miR-129brain | CUUUUUGCGGUCUGGGCUUGC |
| hsa-miR-129-5p | CUUUUUGCGGUCUGGGCUUGCU | ||||
| hsa-miR-129brain | CUUUUUGCGGUCUGGGCUUGC | ||||
| hsa-miR-129-5p | CUUUUUGCGGUCUGGGCUUGCU | ||||
| hsa-miR-129brain | CUUUUUGCGGUCUGGGCUUGC | ||||
| hsa-miR-129-5p | CUUUUUGCGGUCUGGGCUUGCU | ||||
| miR-133 | 516 | 522 | 1A | hsa-miR-133a | UUGGUCCCCUUCAACCAGCUGU |
| hsa-miR-133b | UUGGUCCCCUUCAACCAGCUA | ||||
| hsa-miR-133a | UUGGUCCCCUUCAACCAGCUGU | ||||
| hsa-miR-133b | UUGGUCCCCUUCAACCAGCUA | ||||
| miR-190 | 129 | 136 | 1A,m8 | hsa-miR-190 | UGAUAUGUUUGAUAUAUUAGGU |
| miR-330 | 750 | 756 | 1A | hsa-miR-330brain | GCAAAGCACACGGCCUGCAGAGA |
| miR-376 | 623 | 630 | 1A,m8 | hsa-miR-376a | AUCAUAGAGGAAAAUCCACGU |
| hsa-miR-376b | AUCAUAGAGGAAAAUCCAUGUU | ||||
| miR-450 | 1059 | 1065 | 1A | hsa-miR-450 | UUUUUGCGAUGUGUUCCUAAUA |
| miR-9 | 510 | 516 | m8 | hsa-miR-9SZ | UCUUUGGUUAUCUAGCUGUAUGA |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.