Summary ?
GeneID57107
SymbolPDSS2
SynonymsC6orf210|COQ10D3|DLP1|bA59I9.3|hDLP1
Descriptionprenyl (decaprenyl) diphosphate synthase, subunit 2
ReferenceMIM:610564|HGNC:HGNC:23041|Ensembl:ENSG00000164494|HPRD:12879|Vega:OTTHUMG00000059359
Gene typeprotein-coding
Map location6q21
Pascal p-value0.397
Sherlock p-value0.003
Fetal beta-0.027
eGeneMeta

Gene in Data Sources
Gene set name Method of gene setDescriptionInfo
CV:PGCnpGenome-wide Association StudyGWAS

Section I. Genetics and epigenetics annotation


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0000010trans-hexaprenyltranstransferase activityIDA16262699 
GO:0016740transferase activityIEA-
GO:0046982protein heterodimerization activityIDA16262699 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006744ubiquinone biosynthetic processIDA16262699 
GO:0008299isoprenoid biosynthetic processIDA16262699 

Section V. Pathway annotation

Pathway namePathway size# SZGR 2.0 genes in pathwayInfo
KEGG TERPENOID BACKBONE BIOSYNTHESIS 1510All SZGR 2.0 genes in this pathway
CHEMNITZ RESPONSE TO PROSTAGLANDIN E2 DN 391222All SZGR 2.0 genes in this pathway
RODRIGUES THYROID CARCINOMA ANAPLASTIC DN 537339All SZGR 2.0 genes in this pathway
NUYTTEN EZH2 TARGETS DN 1024594All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE UP 16911088All SZGR 2.0 genes in this pathway
ACEVEDO LIVER TUMOR VS NORMAL ADJACENT TISSUE DN 274165All SZGR 2.0 genes in this pathway
BONOME OVARIAN CANCER SURVIVAL SUBOPTIMAL DEBULKING 510309All SZGR 2.0 genes in this pathway
AGUIRRE PANCREATIC CANCER COPY NUMBER DN 238145All SZGR 2.0 genes in this pathway
HAN SATB1 TARGETS UP 395249All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-203.1101010171A,m8hsa-miR-203UGAAAUGUUUAGGACCACUAG
miR-488141014171A,m8hsa-miR-488CCCAGAUAAUGGCACUCUCAA