SZGR2

Summary ?

GeneID	57142
Symbol	RTN4
Synonyms	ASY\|NI220/250\|NOGO\|NOGO-A\|NOGOC\|NSP\|NSP-CL\|Nbla00271\|Nbla10545\|Nogo-B\|Nogo-C\|RTN-X\|RTN4-A\|RTN4-B1\|RTN4-B2\|RTN4-C
Description	reticulon 4
Reference	MIM:604475\|HGNC:HGNC:14085\|Ensembl:ENSG00000115310\|HPRD:07259\|Vega:OTTHUMG00000129337
Gene type	protein-coding
Map location	2p16.3
Pascal p-value	0.014
Sherlock p-value	0.606
Fetal beta	-5.336
DMG	2 (# studies)
eGene	Anterior cingulate cortex BA24 Caudate basal ganglia Cerebellar Hemisphere Cerebellum Cortex Frontal Cortex BA9 Hippocampus Hypothalamus Nucleus accumbens basal ganglia Putamen basal ganglia Myers' cis & trans Meta
Support	G2Cdb.humanPSD G2Cdb.humanPSP CompositeSet Darnell FMRP targets

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Jaffe_2016	Genome-wide DNA methylation analysis	This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05.	2
DMG:Wockner_2014	Genome-wide DNA methylation analysis	This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24).	2
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Association	A combined odds ratio method (Sun et al. 2008), association studies	2	Link to SZGene
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias	Click to show details
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 1

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg26161045	2	55277080	RTN4	1.634E-4	-0.238	0.033	DMG:Wockner_2014
cg01555122	2	55276516	RTN4	3.67E-9	-0.026	2.35E-6	DMG:Jaffe_2016

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	pvalue	qvalue	TSS distance	eQTL type
rs10994209	chr10	61877705	RTN4	57142		0.17		trans
rs11125553	2	55186928	RTN4	ENSG00000115310.13	1.777E-6	0	152829	gtex_brain_ba24
rs2580764	2	55196956	RTN4	ENSG00000115310.13	1.235E-6	0	142801	gtex_brain_ba24
rs2588510	2	55199248	RTN4	ENSG00000115310.13	1.149E-8	0	140509	gtex_brain_ba24
rs5831331	2	55199557	RTN4	ENSG00000115310.13	1.077E-8	0	140200	gtex_brain_ba24
rs2255112	2	55200800	RTN4	ENSG00000115310.13	1.149E-8	0	138957	gtex_brain_ba24
rs2588521	2	55203931	RTN4	ENSG00000115310.13	1.149E-8	0	135826	gtex_brain_ba24
rs2580765	2	55204028	RTN4	ENSG00000115310.13	1.149E-8	0	135729	gtex_brain_ba24
rs2588514	2	55209177	RTN4	ENSG00000115310.13	8.756E-8	0	130580	gtex_brain_ba24
rs2919129	2	55216545	RTN4	ENSG00000115310.13	1.735E-7	0	123212	gtex_brain_ba24
rs2015919	2	55218026	RTN4	ENSG00000115310.13	4.898E-7	0	121731	gtex_brain_ba24
rs2580772	2	55218805	RTN4	ENSG00000115310.13	3.034E-8	0	120952	gtex_brain_ba24
rs2580773	2	55219989	RTN4	ENSG00000115310.13	1.012E-6	0	119768	gtex_brain_ba24
rs2580776	2	55222132	RTN4	ENSG00000115310.13	1.87E-7	0	117625	gtex_brain_ba24
rs10210840	2	55226009	RTN4	ENSG00000115310.13	1.018E-6	0	113748	gtex_brain_ba24
rs7340476	2	55227346	RTN4	ENSG00000115310.13	2.087E-7	0	112411	gtex_brain_ba24
rs13387751	2	55227375	RTN4	ENSG00000115310.13	2.092E-7	0	112382	gtex_brain_ba24
rs6545466	2	55228392	RTN4	ENSG00000115310.13	8.722E-7	0	111365	gtex_brain_ba24
rs6760429	2	55228499	RTN4	ENSG00000115310.13	2.227E-7	0	111258	gtex_brain_ba24
rs12713284	2	55228861	RTN4	ENSG00000115310.13	2.175E-7	0	110896	gtex_brain_ba24
rs7562292	2	55230219	RTN4	ENSG00000115310.13	1.603E-7	0	109538	gtex_brain_ba24
rs6726158	2	55239202	RTN4	ENSG00000115310.13	8.511E-7	0	100555	gtex_brain_ba24
rs6755468	2	55240026	RTN4	ENSG00000115310.13	1.862E-7	0	99731	gtex_brain_ba24
rs10174838	2	55241216	RTN4	ENSG00000115310.13	8.31E-8	0	98541	gtex_brain_ba24
rs7584430	2	55241686	RTN4	ENSG00000115310.13	1.692E-7	0	98071	gtex_brain_ba24
rs35631428	2	55244438	RTN4	ENSG00000115310.13	1.731E-6	0	95319	gtex_brain_ba24
rs12477711	2	55245177	RTN4	ENSG00000115310.13	2.045E-6	0	94580	gtex_brain_ba24
rs2044291	2	55247954	RTN4	ENSG00000115310.13	2.218E-7	0	91803	gtex_brain_ba24
rs11687609	2	55192280	RTN4	ENSG00000115310.13	3.626E-6	0	147477	gtex_brain_putamen_basal
rs2580764	2	55196956	RTN4	ENSG00000115310.13	5.459E-7	0	142801	gtex_brain_putamen_basal
rs2255393	2	55197882	RTN4	ENSG00000115310.13	6.598E-11	0	141875	gtex_brain_putamen_basal
rs2289747	2	55198385	RTN4	ENSG00000115310.13	4.372E-8	0	141372	gtex_brain_putamen_basal
rs2241959	2	55198399	RTN4	ENSG00000115310.13	4.227E-7	0	141358	gtex_brain_putamen_basal
rs887	2	55199068	RTN4	ENSG00000115310.13	1.656E-8	0	140689	gtex_brain_putamen_basal
rs2588510	2	55199248	RTN4	ENSG00000115310.13	2.626E-9	0	140509	gtex_brain_putamen_basal
rs5831331	2	55199557	RTN4	ENSG00000115310.13	9.963E-10	0	140200	gtex_brain_putamen_basal
rs2255112	2	55200800	RTN4	ENSG00000115310.13	2.626E-9	0	138957	gtex_brain_putamen_basal
rs2588521	2	55203931	RTN4	ENSG00000115310.13	2.626E-9	0	135826	gtex_brain_putamen_basal
rs2580765	2	55204028	RTN4	ENSG00000115310.13	2.626E-9	0	135729	gtex_brain_putamen_basal
rs2588514	2	55209177	RTN4	ENSG00000115310.13	2.502E-7	0	130580	gtex_brain_putamen_basal
rs17418675	2	55210605	RTN4	ENSG00000115310.13	1.874E-6	0	129152	gtex_brain_putamen_basal
rs12464447	2	55212495	RTN4	ENSG00000115310.13	2.489E-6	0	127262	gtex_brain_putamen_basal
rs2919129	2	55216545	RTN4	ENSG00000115310.13	7.281E-8	0	123212	gtex_brain_putamen_basal
rs2015919	2	55218026	RTN4	ENSG00000115310.13	1.153E-7	0	121731	gtex_brain_putamen_basal
rs10496036	2	55218791	RTN4	ENSG00000115310.13	3.343E-6	0	120966	gtex_brain_putamen_basal
rs2580772	2	55218805	RTN4	ENSG00000115310.13	7.281E-8	0	120952	gtex_brain_putamen_basal
rs2580773	2	55219989	RTN4	ENSG00000115310.13	1.721E-7	0	119768	gtex_brain_putamen_basal
rs17046570	2	55220584	RTN4	ENSG00000115310.13	3.343E-6	0	119173	gtex_brain_putamen_basal
rs2580776	2	55222132	RTN4	ENSG00000115310.13	8.517E-8	0	117625	gtex_brain_putamen_basal
rs55659423	2	55222630	RTN4	ENSG00000115310.13	3.55E-6	0	117127	gtex_brain_putamen_basal
rs55698303	2	55222680	RTN4	ENSG00000115310.13	3.337E-6	0	117077	gtex_brain_putamen_basal
rs2588518	2	55223282	RTN4	ENSG00000115310.13	5.4E-8	0	116475	gtex_brain_putamen_basal
rs72795431	2	55225303	RTN4	ENSG00000115310.13	2.648E-6	0	114454	gtex_brain_putamen_basal
rs10210840	2	55226009	RTN4	ENSG00000115310.13	8.612E-7	0	113748	gtex_brain_putamen_basal
rs7340476	2	55227346	RTN4	ENSG00000115310.13	7.466E-8	0	112411	gtex_brain_putamen_basal
rs13387751	2	55227375	RTN4	ENSG00000115310.13	7.469E-8	0	112382	gtex_brain_putamen_basal
rs6545466	2	55228392	RTN4	ENSG00000115310.13	1.058E-7	0	111365	gtex_brain_putamen_basal
rs6760429	2	55228499	RTN4	ENSG00000115310.13	7.515E-8	0	111258	gtex_brain_putamen_basal
rs12713284	2	55228861	RTN4	ENSG00000115310.13	7.677E-8	0	110896	gtex_brain_putamen_basal
rs35826668	2	55229508	RTN4	ENSG00000115310.13	5.384E-7	0	110249	gtex_brain_putamen_basal
rs7562292	2	55230219	RTN4	ENSG00000115310.13	7.354E-8	0	109538	gtex_brain_putamen_basal
rs6726158	2	55239202	RTN4	ENSG00000115310.13	7.889E-7	0	100555	gtex_brain_putamen_basal
rs3806570	2	55239410	RTN4	ENSG00000115310.13	1.015E-7	0	100347	gtex_brain_putamen_basal
rs6755468	2	55240026	RTN4	ENSG00000115310.13	1.045E-7	0	99731	gtex_brain_putamen_basal
rs10174838	2	55241216	RTN4	ENSG00000115310.13	9.382E-8	0	98541	gtex_brain_putamen_basal
rs7584430	2	55241686	RTN4	ENSG00000115310.13	1.139E-8	0	98071	gtex_brain_putamen_basal
rs35631428	2	55244438	RTN4	ENSG00000115310.13	9.794E-7	0	95319	gtex_brain_putamen_basal
rs17046594	2	55244538	RTN4	ENSG00000115310.13	2.188E-6	0	95219	gtex_brain_putamen_basal
rs12477711	2	55245177	RTN4	ENSG00000115310.13	3.339E-8	0	94580	gtex_brain_putamen_basal
rs4672005	2	55246551	RTN4	ENSG00000115310.13	2.484E-7	0	93206	gtex_brain_putamen_basal
rs12464070	2	55247477	RTN4	ENSG00000115310.13	1.33E-7	0	92280	gtex_brain_putamen_basal
rs2044291	2	55247954	RTN4	ENSG00000115310.13	1.258E-7	0	91803	gtex_brain_putamen_basal
rs2902649	2	55248357	RTN4	ENSG00000115310.13	1.342E-7	0	91400	gtex_brain_putamen_basal
rs7570629	2	55255935	RTN4	ENSG00000115310.13	1.04E-6	0	83822	gtex_brain_putamen_basal
rs2968786	2	55264859	RTN4	ENSG00000115310.13	2.075E-6	0	74898	gtex_brain_putamen_basal
rs141145795	2	55265634	RTN4	ENSG00000115310.13	2.152E-6	0	74123	gtex_brain_putamen_basal
rs2968787	2	55265785	RTN4	ENSG00000115310.13	1.757E-7	0	73972	gtex_brain_putamen_basal
rs2972097	2	55267545	RTN4	ENSG00000115310.13	2.143E-6	0	72212	gtex_brain_putamen_basal
rs2860453	2	55270485	RTN4	ENSG00000115310.13	2.113E-7	0	69272	gtex_brain_putamen_basal
rs2920893	2	55270629	RTN4	ENSG00000115310.13	1.678E-7	0	69128	gtex_brain_putamen_basal
rs2920900	2	55280083	RTN4	ENSG00000115310.13	1.184E-6	0	59674	gtex_brain_putamen_basal
rs2968790	2	55280594	RTN4	ENSG00000115310.13	6.018E-8	0	59163	gtex_brain_putamen_basal
rs1822616	2	55283878	RTN4	ENSG00000115310.13	6.838E-8	0	55879	gtex_brain_putamen_basal
rs2968793	2	55285024	RTN4	ENSG00000115310.13	4.883E-8	0	54733	gtex_brain_putamen_basal
rs13011689	2	55287079	RTN4	ENSG00000115310.13	1.085E-7	0	52678	gtex_brain_putamen_basal
rs2968796	2	55287835	RTN4	ENSG00000115310.13	5.102E-8	0	51922	gtex_brain_putamen_basal
rs2968795	2	55287989	RTN4	ENSG00000115310.13	1.083E-7	0	51768	gtex_brain_putamen_basal
rs565402040	2	55289148	RTN4	ENSG00000115310.13	8.566E-7	0	50609	gtex_brain_putamen_basal
rs2968794	2	55290651	RTN4	ENSG00000115310.13	3.313E-7	0	49106	gtex_brain_putamen_basal
rs11674808	2	55291671	RTN4	ENSG00000115310.13	1.418E-7	0	48086	gtex_brain_putamen_basal
rs2972075	2	55292322	RTN4	ENSG00000115310.13	1.328E-7	0	47435	gtex_brain_putamen_basal
rs34557804	2	55294571	RTN4	ENSG00000115310.13	1.313E-7	0	45186	gtex_brain_putamen_basal
rs2972072	2	55295370	RTN4	ENSG00000115310.13	5.686E-8	0	44387	gtex_brain_putamen_basal
rs2920878	2	55296415	RTN4	ENSG00000115310.13	1.338E-7	0	43342	gtex_brain_putamen_basal
rs2968827	2	55297629	RTN4	ENSG00000115310.13	1.797E-7	0	42128	gtex_brain_putamen_basal
rs2972071	2	55300749	RTN4	ENSG00000115310.13	6.272E-8	0	39008	gtex_brain_putamen_basal
rs2972070	2	55301691	RTN4	ENSG00000115310.13	1.697E-7	0	38066	gtex_brain_putamen_basal
rs2968825	2	55303042	RTN4	ENSG00000115310.13	3.822E-7	0	36715	gtex_brain_putamen_basal
rs2968822	2	55307811	RTN4	ENSG00000115310.13	2.619E-7	0	31946	gtex_brain_putamen_basal
rs2968821	2	55307865	RTN4	ENSG00000115310.13	9.645E-9	0	31892	gtex_brain_putamen_basal
rs2920891	2	55308037	RTN4	ENSG00000115310.13	1.035E-8	0	31720	gtex_brain_putamen_basal
rs2920882	2	55312270	RTN4	ENSG00000115310.13	3.034E-6	0	27487	gtex_brain_putamen_basal
rs2968798	2	55314611	RTN4	ENSG00000115310.13	2.905E-6	0	25146	gtex_brain_putamen_basal
rs2920862	2	55316938	RTN4	ENSG00000115310.13	1.943E-6	0	22819	gtex_brain_putamen_basal
rs2968805	2	55319460	RTN4	ENSG00000115310.13	3.187E-6	0	20297	gtex_brain_putamen_basal
rs2968809	2	55323803	RTN4	ENSG00000115310.13	1.865E-6	0	15954	gtex_brain_putamen_basal

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005515	protein binding	IPI		11126360
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0030517	negative regulation of axon extension	IDA	axon (GO term level: 15)	10667797
GO:0019987	negative regulation of anti-apoptosis	IMP		11126360
GO:0042981	regulation of apoptosis	NAS		11126360
GO:0030334	regulation of cell migration	IDA		15034570
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005789	endoplasmic reticulum membrane	IEA		-
GO:0005635	nuclear envelope	IDA		11126360
GO:0005783	endoplasmic reticulum	IEA		-
GO:0005783	endoplasmic reticulum	NAS		11126360
GO:0016020	membrane	IEA		-
GO:0016021	integral to membrane	IEA		-
GO:0030176	integral to endoplasmic reticulum membrane	IDA		10667797

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
BCL2	Bcl-2	B-cell CLL/lymphoma 2	RTN-XS interacts with Bcl-2.	BIND	11126360
BCL2	Bcl-2	B-cell CLL/lymphoma 2	-	HPRD,BioGRID	11126360
BCL2L1	BCL-XL/S \| BCL2L \| BCLX \| Bcl-X \| DKFZp781P2092 \| bcl-xL \| bcl-xS	BCL2-like 1	-	HPRD,BioGRID	11126360
BCL2L1	BCL-XL/S \| BCL2L \| BCLX \| Bcl-X \| DKFZp781P2092 \| bcl-xL \| bcl-xS	BCL2-like 1	RTN-XS interacts with Bcl-XL.	BIND	11126360
CNTNAP1	CASPR \| CNTNAP \| NRXN4 \| P190	contactin associated protein 1	-	HPRD,BioGRID	14592966
COL4A3BP	CERT \| CERTL \| FLJ20597 \| GPBP \| STARD11	collagen, type IV, alpha 3 (Goodpasture antigen) binding protein	Two-hybrid	BioGRID	16189514
CRMP1	DPYSL1 \| DRP-1 \| DRP1	collapsin response mediator protein 1	Two-hybrid	BioGRID	16169070
FXR2	FMR1L2	fragile X mental retardation, autosomal homolog 2	Two-hybrid	BioGRID	16189514
KCNA1	AEMK \| EA1 \| HBK1 \| HUK1 \| KV1.1 \| MBK1 \| MGC126782 \| MGC138385 \| MK1 \| RBK1	potassium voltage-gated channel, shaker-related subfamily, member 1 (episodic ataxia with myokymia)	Affinity Capture-Western	BioGRID	14592966
KCNA2	HBK5 \| HK4 \| HUKIV \| KV1.2 \| MGC50217 \| MK2 \| NGK1 \| RBK2	potassium voltage-gated channel, shaker-related subfamily, member 2	Affinity Capture-Western	BioGRID	14592966
LRCH4	FLJ40101 \| FLJ46315 \| LRN \| LRRN1 \| LRRN4 \| PP14183 \| SAP25	leucine-rich repeats and calponin homology (CH) domain containing 4	Two-hybrid	BioGRID	16189514
LRPAP1	A2MRAP \| A2RAP \| HBP44 \| MGC138272 \| MRAP \| RAP	low density lipoprotein receptor-related protein associated protein 1	Two-hybrid	BioGRID	16169070
NAPA	SNAPA	N-ethylmaleimide-sensitive factor attachment protein, alpha	Two-hybrid	BioGRID	16189514
PLEKHF2	FLJ13187 \| PHAFIN2 \| ZFYVE18	pleckstrin homology domain containing, family F (with FYVE domain) member 2	Two-hybrid	BioGRID	16189514
PRR13	DKFZp564J157 \| FLJ23818 \| TXR1	proline rich 13	Two-hybrid	BioGRID	16169070
RAB33A	MGC1488 \| RabS10	RAB33A, member RAS oncogene family	Two-hybrid	BioGRID	16189514
RTN3	ASYIP \| HAP \| NSPL2 \| NSPLII \| RTN3-A1	reticulon 3	Two-hybrid	BioGRID	16189514
RTN4IP1	MGC12934 \| NIMP	reticulon 4 interacting protein 1	-	HPRD,BioGRID	12067236
RTN4IP1	MGC12934 \| NIMP	reticulon 4 interacting protein 1	Nogo-A interacts with NIMP.	BIND	12067236
RTN4R	NGR \| NOGOR	reticulon 4 receptor	-	HPRD	11201742
RTN4R	NGR \| NOGOR	reticulon 4 receptor	Nogo-66 interacts with NgR.	BIND	15694321
SIRT2	SIR2 \| SIR2L \| SIR2L2	sirtuin (silent mating type information regulation 2 homolog) 2 (S. cerevisiae)	Affinity Capture-MS	BioGRID	17353931
SPG21	ACP33 \| BM-019 \| GL010 \| MASPARDIN \| MAST	spastic paraplegia 21 (autosomal recessive, Mast syndrome)	Two-hybrid	BioGRID	16189514
UQCRC1	D3S3191 \| QCR1 \| UQCR1	ubiquinol-cytochrome c reductase core protein I	Nogo-A interacts with UQCRC1.	BIND	12067236
UQCRC1	D3S3191 \| QCR1 \| UQCR1	ubiquinol-cytochrome c reductase core protein I	-	HPRD,BioGRID	12067236
UQCRC2	QCR2 \| UQCR2	ubiquinol-cytochrome c reductase core protein II	Nogo-A interacts with UQCRC2.	BIND	12067236
UQCRC2	QCR2 \| UQCR2	ubiquinol-cytochrome c reductase core protein II	-	HPRD,BioGRID	12067236

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
PID P75 NTR PATHWAY	69	51	All SZGR 2.0 genes in this pathway
REACTOME SIGNALLING BY NGF	217	167	All SZGR 2.0 genes in this pathway
REACTOME P75 NTR RECEPTOR MEDIATED SIGNALLING	81	61	All SZGR 2.0 genes in this pathway
WATANABE RECTAL CANCER RADIOTHERAPY RESPONSIVE DN	92	51	All SZGR 2.0 genes in this pathway
BERTUCCI MEDULLARY VS DUCTAL BREAST CANCER DN	169	118	All SZGR 2.0 genes in this pathway
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP	1382	904	All SZGR 2.0 genes in this pathway
DEURIG T CELL PROLYMPHOCYTIC LEUKEMIA DN	320	184	All SZGR 2.0 genes in this pathway
CHARAFE BREAST CANCER LUMINAL VS MESENCHYMAL DN	460	312	All SZGR 2.0 genes in this pathway
LUI THYROID CANCER PAX8 PPARG DN	45	29	All SZGR 2.0 genes in this pathway
LUI THYROID CANCER CLUSTER 3	28	16	All SZGR 2.0 genes in this pathway
LUI TARGETS OF PAX8 PPARG FUSION	34	23	All SZGR 2.0 genes in this pathway
SCHLOSSER SERUM RESPONSE DN	712	443	All SZGR 2.0 genes in this pathway
SPIELMAN LYMPHOBLAST EUROPEAN VS ASIAN UP	479	299	All SZGR 2.0 genes in this pathway
NUYTTEN NIPP1 TARGETS DN	848	527	All SZGR 2.0 genes in this pathway
FUJIWARA PARK2 HEPATOCYTE PROLIFERATION DN	8	7	All SZGR 2.0 genes in this pathway
PETRETTO CARDIAC HYPERTROPHY	34	26	All SZGR 2.0 genes in this pathway
SANA RESPONSE TO IFNG DN	85	56	All SZGR 2.0 genes in this pathway
FLECHNER BIOPSY KIDNEY TRANSPLANT REJECTED VS OK DN	546	351	All SZGR 2.0 genes in this pathway
PENG RAPAMYCIN RESPONSE DN	245	154	All SZGR 2.0 genes in this pathway
ADDYA ERYTHROID DIFFERENTIATION BY HEMIN	73	47	All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE DN	1237	837	All SZGR 2.0 genes in this pathway
RODWELL AGING KIDNEY NO BLOOD DN	150	93	All SZGR 2.0 genes in this pathway
KAAB HEART ATRIUM VS VENTRICLE UP	249	170	All SZGR 2.0 genes in this pathway
RODWELL AGING KIDNEY DN	145	88	All SZGR 2.0 genes in this pathway
DAZARD RESPONSE TO UV SCC UP	123	75	All SZGR 2.0 genes in this pathway
LEE METASTASIS AND ALTERNATIVE SPLICING UP	74	51	All SZGR 2.0 genes in this pathway
MARTINEZ RB1 TARGETS UP	673	430	All SZGR 2.0 genes in this pathway
MARTINEZ TP53 TARGETS UP	602	364	All SZGR 2.0 genes in this pathway
MARTINEZ RB1 AND TP53 TARGETS UP	601	369	All SZGR 2.0 genes in this pathway
WEST ADRENOCORTICAL TUMOR UP	294	199	All SZGR 2.0 genes in this pathway
MOOTHA PGC	420	269	All SZGR 2.0 genes in this pathway
MILI PSEUDOPODIA CHEMOTAXIS DN	457	302	All SZGR 2.0 genes in this pathway
MILI PSEUDOPODIA HAPTOTAXIS DN	668	419	All SZGR 2.0 genes in this pathway
KIM ALL DISORDERS CALB1 CORR UP	548	370	All SZGR 2.0 genes in this pathway
KOINUMA TARGETS OF SMAD2 OR SMAD3	824	528	All SZGR 2.0 genes in this pathway
TERAO AOX4 TARGETS SKIN UP	38	27	All SZGR 2.0 genes in this pathway
GOBERT OLIGODENDROCYTE DIFFERENTIATION DN	1080	713	All SZGR 2.0 genes in this pathway
GUILLAUMOND KLF10 TARGETS DN	30	15	All SZGR 2.0 genes in this pathway
RAO BOUND BY SALL4 ISOFORM B	517	302	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-132/212	509	515	1A	hsa-miR-212^SZ	UAACAGUCUCCAGUCACGGCC
miR-132/212	509	515	1A	hsa-miR-132^brain	UAACAGUCUACAGCCAUGGUCG
miR-153	840	846	1A	hsa-miR-153	UUGCAUAGUCACAAAAGUGA
miR-182	522	528	m8	hsa-miR-182	UUUGGCAAUGGUAGAACUCACA
miR-218	649	655	m8	hsa-miR-218^brain	UUGUGCUUGAUCUAACCAUGU
miR-448	840	846	1A	hsa-miR-448	UUGCAUAUGUAGGAUGUCCCAU
miR-455	651	657	1A	hsa-miR-455	UAUGUGCCUUUGGACUACAUCG
miR-491	594	600	1A	hsa-miR-491^brain	AGUGGGGAACCCUUCCAUGAGGA

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: RTN4