Summary ?
GeneID57216
SymbolVANGL2
SynonymsLPP1|LTAP|STB1|STBM|STBM1
DescriptionVANGL planar cell polarity protein 2
ReferenceMIM:600533|HGNC:HGNC:15511|Ensembl:ENSG00000162738|HPRD:02758|Vega:OTTHUMG00000033122
Gene typeprotein-coding
Map location1q23.2
Sherlock p-value0.059
Fetal beta1.999
DMG1 (# studies)
eGeneCerebellar Hemisphere
Cerebellum
Myers' cis & trans
Meta

Gene in Data Sources
Gene set name Method of gene setDescriptionInfo
CV:PGCnpGenome-wide Association StudyGWAS
DMG:Wockner_2014Genome-wide DNA methylation analysisThis dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). 2
GSMA_IGenome scan meta-analysisPsr: 0.0235 
GSMA_IIAGenome scan meta-analysis (All samples)Psr: 0.00814 
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 1 

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

ProbeChromosomePositionNearest geneP (dis)Beta (dis)FDR (dis)Study
cg134284801160370208VANGL24.03E-5-0.4330.02DMG:Wockner_2014
cg116599611160369972VANGL24.32E-4-0.6320.045DMG:Wockner_2014

@eQTL annotation

SNP IDChromosomePositioneGeneGene Entrez IDpvalueqvalueTSS distanceeQTL type
rs16829545chr2151977407VANGL2572160.01trans
rs16955618chr1529937543VANGL2572160.04trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005515protein bindingISS-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0035058sensory cilium biogenesisISSneuron (GO term level: 10)-
GO:0001736establishment of planar polarityISS-
GO:0001843neural tube closureISS-
GO:0001947heart loopingISS-
GO:0007275multicellular organismal developmentIEA-
GO:0045176apical protein localizationISS-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0016020membraneIEA-
GO:0016021integral to membraneISS-

Section V. Pathway annotation

Pathway namePathway size# SZGR 2.0 genes in pathwayInfo
KEGG WNT SIGNALING PATHWAY 151112All SZGR 2.0 genes in this pathway
LIU PROSTATE CANCER DN 481290All SZGR 2.0 genes in this pathway
SENGUPTA NASOPHARYNGEAL CARCINOMA UP 294178All SZGR 2.0 genes in this pathway
SENESE HDAC3 TARGETS DN 536332All SZGR 2.0 genes in this pathway
DODD NASOPHARYNGEAL CARCINOMA DN 1375806All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN 17811082All SZGR 2.0 genes in this pathway
GRAESSMANN RESPONSE TO MC AND DOXORUBICIN DN 770415All SZGR 2.0 genes in this pathway
GROSS HYPOXIA VIA ELK3 DN 156106All SZGR 2.0 genes in this pathway
GUENTHER GROWTH SPHERICAL VS ADHERENT UP 2115All SZGR 2.0 genes in this pathway
SCHAEFFER PROSTATE DEVELOPMENT 6HR DN 514330All SZGR 2.0 genes in this pathway
ROZANOV MMP14 TARGETS UP 266171All SZGR 2.0 genes in this pathway
BILD HRAS ONCOGENIC SIGNATURE 261166All SZGR 2.0 genes in this pathway
MARTENS TRETINOIN RESPONSE UP 857456All SZGR 2.0 genes in this pathway
ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY 1839928All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
let-7/9825902596m8hsa-let-7abrainUGAGGUAGUAGGUUGUAUAGUU
hsa-let-7bbrainUGAGGUAGUAGGUUGUGUGGUU
hsa-let-7cbrainUGAGGUAGUAGGUUGUAUGGUU
hsa-let-7dbrainAGAGGUAGUAGGUUGCAUAGU
hsa-let-7ebrainUGAGGUAGGAGGUUGUAUAGU
hsa-let-7fbrainUGAGGUAGUAGAUUGUAUAGUU
hsa-miR-98brainUGAGGUAGUAAGUUGUAUUGUU
hsa-let-7gSZUGAGGUAGUAGUUUGUACAGU
hsa-let-7ibrainUGAGGUAGUAGUUUGUGCUGU
hsa-let-7abrainUGAGGUAGUAGGUUGUAUAGUU
hsa-let-7bbrainUGAGGUAGUAGGUUGUGUGGUU
hsa-let-7cbrainUGAGGUAGUAGGUUGUAUGGUU
hsa-let-7dbrainAGAGGUAGUAGGUUGCAUAGU
hsa-let-7ebrainUGAGGUAGGAGGUUGUAUAGU
hsa-let-7fbrainUGAGGUAGUAGAUUGUAUAGUU
hsa-miR-98brainUGAGGUAGUAAGUUGUAUUGUU
hsa-let-7gSZUGAGGUAGUAGUUUGUACAGU
hsa-let-7ibrainUGAGGUAGUAGUUUGUGCUGU
miR-125/35110801086m8hsa-miR-125bbrainUCCCUGAGACCCUAACUUGUGA
hsa-miR-125abrainUCCCUGAGACCCUUUAACCUGUG
miR-128204120481A,m8hsa-miR-128aUCACAGUGAACCGGUCUCUUUU
hsa-miR-128bUCACAGUGAACCGGUCUCUUUC
miR-21630323038m8hsa-miR-216UAAUCUCAGCUGGCAACUGUG
miR-261181251A,m8hsa-miR-26abrainUUCAAGUAAUCCAGGAUAGGC
hsa-miR-26bSZUUCAAGUAAUUCAGGAUAGGUU
miR-2720422048m8hsa-miR-27abrainUUCACAGUGGCUAAGUUCCGC
hsa-miR-27bbrainUUCACAGUGGCUAAGUUCUGC
miR-37822252231m8hsa-miR-378CUCCUGACUCCAGGUCCUGUGU
miR-410326432701Ahsa-miR-410AAUAUAACACAGAUGGCCUGU
miR-493-5p325032561Ahsa-miR-493-5pUUGUACAUGGUAGGCUUUCAUU
miR-496314531511Ahsa-miR-496AUUACAUGGCCAAUCUC
miR-50411071113m8hsa-miR-504AGACCCUGGUCUGCACUCUAU