Summary ?
GeneID57282
SymbolSLC4A10
SynonymsNBCn2|NCBE
Descriptionsolute carrier family 4 member 10
ReferenceMIM:605556|HGNC:HGNC:13811|Ensembl:ENSG00000144290|Vega:OTTHUMG00000153938
Gene typeprotein-coding
Map location2q24.2
Pascal p-value0.036
Fetal beta-1.319
SupportION BALANCE
G2Cdb.humanPSD
G2Cdb.humanPSP
Potential synaptic genes

Gene in Data Sources
Gene set name Method of gene setDescriptionInfo
CV:GWAScatGenome-wide Association StudiesThis data set includes 560 SNPs associated with schizophrenia. A total of 486 genes were mapped to these SNPs within 50kb.
CV:PGC128Genome-wide Association StudyA multi-stage schizophrenia GWAS of up to 36,989 cases and 113,075 controls. Reported by the Schizophrenia Working Group of PGC. 128 independent associations spanning 108 loci
CV:PGCnpGenome-wide Association StudyGWAS
GSMA_IIAGenome scan meta-analysis (All samples)Psr: 0.02395 

Section I. Genetics and epigenetics annotation

@CV:PGC128

SNP IDChromosomePositionAllelePFunctionGeneUp/Down Distance
rs2909457chr2162845855AG4.375E-8intergenicSLC4A10,DPP4dist=4069;dist=2900


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005452inorganic anion exchanger activityIEA-
GO:0005215transporter activityIEA-
GO:0008509anion transmembrane transporter activityIEA-
GO:0015293symporter activityIEA-
GO:0015297antiporter activityIEA-
GO:0031402sodium ion bindingIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006821chloride transportNAS10993873 
GO:0006820anion transportIEA-
GO:0006814sodium ion transportIEA-
GO:0015701bicarbonate transportNAS10993873 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0016021integral to membraneNAS10993873 
GO:0005886plasma membraneIEA-

Section V. Pathway annotation

Pathway namePathway size# SZGR 2.0 genes in pathwayInfo
HUTTMANN B CLL POOR SURVIVAL UP 276187All SZGR 2.0 genes in this pathway
GAUSSMANN MLL AF4 FUSION TARGETS A DN 9061All SZGR 2.0 genes in this pathway
TERAMOTO OPN TARGETS CLUSTER 7 1916All SZGR 2.0 genes in this pathway
LEE TARGETS OF PTCH1 AND SUFU DN 8369All SZGR 2.0 genes in this pathway
AFFAR YY1 TARGETS DN 234137All SZGR 2.0 genes in this pathway
MOREAUX MULTIPLE MYELOMA BY TACI UP 412249All SZGR 2.0 genes in this pathway
MARTINEZ RB1 TARGETS DN 543317All SZGR 2.0 genes in this pathway
MARTINEZ TP53 TARGETS UP 602364All SZGR 2.0 genes in this pathway
MARTINEZ RB1 AND TP53 TARGETS UP 601369All SZGR 2.0 genes in this pathway
MCCABE BOUND BY HOXC6 469239All SZGR 2.0 genes in this pathway
MIKKELSEN ES ICP WITH H3K4ME3 718401All SZGR 2.0 genes in this pathway
PURBEY TARGETS OF CTBP1 NOT SATB1 UP 344215All SZGR 2.0 genes in this pathway
YANG BCL3 TARGETS UP 364236All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-125/35157641A,m8hsa-miR-125bbrainUCCCUGAGACCCUAACUUGUGA
hsa-miR-125abrainUCCCUGAGACCCUUUAACCUGUG
miR-3301551621A,m8hsa-miR-330brainGCAAAGCACACGGCCUGCAGAGA
miR-33973801A,m8hsa-miR-339UCCCUGUCCUCCAGGAGCUCA
miR-3768793m8hsa-miR-376aAUCAUAGAGGAAAAUCCACGU
hsa-miR-376bAUCAUAGAGGAAAAUCCAUGUU