Gene Page: SENP7
Summary ?
| GeneID | 57337 |
| Symbol | SENP7 |
| Synonyms | - |
| Description | SUMO1/sentrin specific peptidase 7 |
| Reference | MIM:612846|HGNC:HGNC:30402|Ensembl:ENSG00000138468|HPRD:07154|Vega:OTTHUMG00000149927 |
| Gene type | protein-coding |
| Map location | 3q12 |
| Pascal p-value | 0.458 |
| Fetal beta | 2.084 |
| DMG | 1 (# studies) |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:GWASdb | Genome-wide Association Studies | GWASdb records for schizophrenia | |
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DMG:Jaffe_2016 | Genome-wide DNA methylation analysis | This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. | 1 |
| GSMA_IIE | Genome scan meta-analysis (European-ancestry samples) | Psr: 0.04359 | |
| GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.04047 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
| Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
|---|---|---|---|---|---|---|---|
| cg03445127 | 3 | 101232168 | SENP7 | 1.69E-9 | -0.01 | 1.49E-6 | DMG:Jaffe_2016 |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0008234 | cysteine-type peptidase activity | NAS | - | |
| GO:0008233 | peptidase activity | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0006508 | proteolysis | IEA | - | |
| GO:0006511 | ubiquitin-dependent protein catabolic process | IEA | - | |
| GO:0016925 | protein sumoylation | ISS | 10652325 | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005622 | intracellular | IDA | 11256614 | |
| GO:0005634 | nucleus | ISS | 10652325 |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| TONKS TARGETS OF RUNX1 RUNX1T1 FUSION HSC UP | 185 | 126 | All SZGR 2.0 genes in this pathway |
| NOUZOVA TRETINOIN AND H4 ACETYLATION | 143 | 85 | All SZGR 2.0 genes in this pathway |
| LEE RECENT THYMIC EMIGRANT | 227 | 128 | All SZGR 2.0 genes in this pathway |
| WANG RESPONSE TO GSK3 INHIBITOR SB216763 UP | 397 | 206 | All SZGR 2.0 genes in this pathway |
| JOHNSTONE PARVB TARGETS 3 DN | 918 | 550 | All SZGR 2.0 genes in this pathway |
| BRUINS UVC RESPONSE VIA TP53 GROUP A | 898 | 516 | All SZGR 2.0 genes in this pathway |
| FORTSCHEGGER PHF8 TARGETS DN | 784 | 464 | All SZGR 2.0 genes in this pathway |
| PEDRIOLI MIR31 TARGETS DN | 418 | 245 | All SZGR 2.0 genes in this pathway |
| ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY | 1839 | 928 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-138 | 55 | 61 | 1A | hsa-miR-138brain | AGCUGGUGUUGUGAAUC |
| miR-144 | 460 | 466 | m8 | hsa-miR-144 | UACAGUAUAGAUGAUGUACUAG |
| miR-153 | 272 | 278 | 1A | hsa-miR-153 | UUGCAUAGUCACAAAAGUGA |
| miR-217 | 449 | 456 | 1A,m8 | hsa-miR-217 | UACUGCAUCAGGAACUGAUUGGAU |
| miR-448 | 272 | 278 | 1A | hsa-miR-448 | UUGCAUAUGUAGGAUGUCCCAU |
| miR-485-3p | 454 | 460 | 1A | hsa-miR-485-3p | GUCAUACACGGCUCUCCUCUCU |
| miR-543 | 296 | 302 | m8 | hsa-miR-543 | AAACAUUCGCGGUGCACUUCU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.