Gene Page: CLK4
Summary ?
| GeneID | 57396 |
| Symbol | CLK4 |
| Synonyms | - |
| Description | CDC like kinase 4 |
| Reference | MIM:607969|HGNC:HGNC:13659|Ensembl:ENSG00000113240|HPRD:12140|Vega:OTTHUMG00000130893 |
| Gene type | protein-coding |
| Map location | 5q35 |
| Pascal p-value | 0.745 |
| Sherlock p-value | 0.339 |
| Fetal beta | 1.819 |
| DMG | 2 (# studies) |
| eGene | Cerebellum Myers' cis & trans Meta |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DMG:Jaffe_2016 | Genome-wide DNA methylation analysis | This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. | 2 |
| DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 2 |
| GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.0276 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
| Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
|---|---|---|---|---|---|---|---|
| cg08812692 | 5 | 178052235 | CLK4 | 7.47E-5 | 0.474 | 0.025 | DMG:Wockner_2014 |
| cg23202349 | 5 | 178053533 | CLK4 | 1.98E-9 | -0.01 | 1.63E-6 | DMG:Jaffe_2016 |
eQTL annotation
| SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
|---|---|---|---|---|---|---|---|---|
| rs17572651 | chr1 | 218943612 | CLK4 | 57396 | 8.49E-4 | trans | ||
| snp_a-1919794 | 0 | CLK4 | 57396 | 0.11 | trans | |||
| rs7584986 | chr2 | 184111432 | CLK4 | 57396 | 4.696E-9 | trans | ||
| rs6729020 | chr2 | 189064719 | CLK4 | 57396 | 0.1 | trans | ||
| rs1368303 | chr5 | 147672388 | CLK4 | 57396 | 4.595E-4 | trans | ||
| rs10259703 | chr7 | 14090856 | CLK4 | 57396 | 0.02 | trans | ||
| rs6989594 | chr8 | 126303866 | CLK4 | 57396 | 0.11 | trans | ||
| rs9409946 | chr9 | 138293640 | CLK4 | 57396 | 0.16 | trans | ||
| rs17104720 | chr14 | 77127308 | CLK4 | 57396 | 0 | trans | ||
| rs6574467 | chr14 | 79179744 | CLK4 | 57396 | 0.01 | trans | ||
| rs10146003 | chr14 | 79191170 | CLK4 | 57396 | 0.01 | trans | ||
| rs16955618 | chr15 | 29937543 | CLK4 | 57396 | 1.7E-8 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0000166 | nucleotide binding | IEA | - | |
| GO:0005524 | ATP binding | IEA | - | |
| GO:0004674 | protein serine/threonine kinase activity | IEA | - | |
| GO:0004713 | protein tyrosine kinase activity | IEA | - | |
| GO:0016740 | transferase activity | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0006468 | protein amino acid phosphorylation | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005634 | nucleus | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| NAKAMURA TUMOR ZONE PERIPHERAL VS CENTRAL DN | 634 | 384 | All SZGR 2.0 genes in this pathway |
| SENGUPTA NASOPHARYNGEAL CARCINOMA WITH LMP1 UP | 408 | 247 | All SZGR 2.0 genes in this pathway |
| GRAHAM CML QUIESCENT VS NORMAL DIVIDING UP | 57 | 33 | All SZGR 2.0 genes in this pathway |
| NADERI BREAST CANCER PROGNOSIS DN | 18 | 13 | All SZGR 2.0 genes in this pathway |
| GRAESSMANN APOPTOSIS BY DOXORUBICIN DN | 1781 | 1082 | All SZGR 2.0 genes in this pathway |
| BUYTAERT PHOTODYNAMIC THERAPY STRESS UP | 811 | 508 | All SZGR 2.0 genes in this pathway |
| GEORGES TARGETS OF MIR192 AND MIR215 | 893 | 528 | All SZGR 2.0 genes in this pathway |
| BYSTROEM CORRELATED WITH IL5 DN | 64 | 47 | All SZGR 2.0 genes in this pathway |
| BYSTRYKH HEMATOPOIESIS STEM CELL QTL TRANS | 882 | 572 | All SZGR 2.0 genes in this pathway |
| PARK HSC MARKERS | 44 | 31 | All SZGR 2.0 genes in this pathway |
| WANG SMARCE1 TARGETS DN | 371 | 218 | All SZGR 2.0 genes in this pathway |
| LEE METASTASIS AND ALTERNATIVE SPLICING DN | 45 | 31 | All SZGR 2.0 genes in this pathway |
| MITSIADES RESPONSE TO APLIDIN UP | 439 | 257 | All SZGR 2.0 genes in this pathway |
| EHLERS ANEUPLOIDY UP | 41 | 29 | All SZGR 2.0 genes in this pathway |
| CHEN HOXA5 TARGETS 9HR UP | 223 | 132 | All SZGR 2.0 genes in this pathway |
| YAO TEMPORAL RESPONSE TO PROGESTERONE CLUSTER 2 | 86 | 50 | All SZGR 2.0 genes in this pathway |
| PHONG TNF RESPONSE NOT VIA P38 | 337 | 236 | All SZGR 2.0 genes in this pathway |
| SMIRNOV RESPONSE TO IR 6HR UP | 166 | 97 | All SZGR 2.0 genes in this pathway |
| ZWANG TRANSIENTLY UP BY 2ND EGF PULSE ONLY | 1725 | 838 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-186 | 363 | 370 | 1A,m8 | hsa-miR-186 | CAAAGAAUUCUCCUUUUGGGCUU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.