Summary ?
GeneID5741
SymbolPTH
SynonymsPTH1
Descriptionparathyroid hormone
ReferenceMIM:168450|HGNC:HGNC:9606|Ensembl:ENSG00000152266|HPRD:01345|Vega:OTTHUMG00000165785
Gene typeprotein-coding
Map location11p15.3
Pascal p-value0.294

Gene in Data Sources
Gene set name Method of gene setDescriptionInfo
CV:PGCnpGenome-wide Association StudyGWAS
PMID:cooccurHigh-throughput literature-searchSystematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophreniasClick to show details
NetworkShortest path distance of core genes in the Human protein-protein interaction networkContribution to shortest path in PPI network: 0.0359 

Section I. Genetics and epigenetics annotation


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005179hormone activityTAS10499494 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0001501skeletal system developmentTAS10913913 
GO:0007186G-protein coupled receptor protein signaling pathwayTAS7797535 
GO:0007267cell-cell signalingTAS7721880 
GO:0008628induction of apoptosis by hormonesTAS10913913 
GO:0006874cellular calcium ion homeostasisNAS-
GO:0046058cAMP metabolic processTAS9927325 
GO:0045453bone resorptionNAS15080150 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005576extracellular regionNAS14718574 

Section V. Pathway annotation

Pathway namePathway size# SZGR 2.0 genes in pathwayInfo
REACTOME SIGNALING BY GPCR 920449All SZGR 2.0 genes in this pathway
REACTOME CLASS B 2 SECRETIN FAMILY RECEPTORS 8858All SZGR 2.0 genes in this pathway
REACTOME GPCR DOWNSTREAM SIGNALING 805368All SZGR 2.0 genes in this pathway
REACTOME G ALPHA S SIGNALLING EVENTS 12182All SZGR 2.0 genes in this pathway
REACTOME GPCR LIGAND BINDING 408246All SZGR 2.0 genes in this pathway
ZHOU INFLAMMATORY RESPONSE FIMA DN 284156All SZGR 2.0 genes in this pathway
SUZUKI AMPLIFIED IN ORAL CANCER 1612All SZGR 2.0 genes in this pathway
KYNG DNA DAMAGE BY GAMMA AND UV RADIATION 8865All SZGR 2.0 genes in this pathway
KYNG DNA DAMAGE UP 226164All SZGR 2.0 genes in this pathway
KONDO PROSTATE CANCER WITH H3K27ME3 19693All SZGR 2.0 genes in this pathway
BONCI TARGETS OF MIR15A AND MIR16 1 9175All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS UP 1305895All SZGR 2.0 genes in this pathway
KYNG WERNER SYNDROM AND NORMAL AGING DN 225124All SZGR 2.0 genes in this pathway
WONG ADULT TISSUE STEM MODULE 721492All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 30MIN DN 15099All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-15/16/195/424/49757641A,m8hsa-miR-15abrainUAGCAGCACAUAAUGGUUUGUG
hsa-miR-16brainUAGCAGCACGUAAAUAUUGGCG
hsa-miR-15bbrainUAGCAGCACAUCAUGGUUUACA
hsa-miR-195SZUAGCAGCACAGAAAUAUUGGC
hsa-miR-424CAGCAGCAAUUCAUGUUUUGAA
hsa-miR-497CAGCAGCACACUGUGGUUUGU
miR-50358641Ahsa-miR-503UAGCAGCGGGAACAGUUCUGCAG