Summary ?
GeneID57414
SymbolRHBDD2
SynonymsNPD007|RHBDL7
Descriptionrhomboid domain containing 2
ReferenceMIM:615203|HGNC:HGNC:23082|Ensembl:ENSG00000005486|HPRD:11492|Vega:OTTHUMG00000156435
Gene typeprotein-coding
Map location7q11.23
Pascal p-value0.52
Sherlock p-value0.026
Fetal beta-0.588

Gene in Data Sources
Gene set name Method of gene setDescriptionInfo
CV:PGCnpGenome-wide Association StudyGWAS
ExpressionMeta-analysis of gene expressionP value: 1.437 

Section I. Genetics and epigenetics annotation


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0016020membraneIEA-
GO:0016021integral to membraneIEA-

Section V. Pathway annotation

Pathway namePathway size# SZGR 2.0 genes in pathwayInfo
FULCHER INFLAMMATORY RESPONSE LECTIN VS LPS UP 579346All SZGR 2.0 genes in this pathway
MATSUDA NATURAL KILLER DIFFERENTIATION 475313All SZGR 2.0 genes in this pathway
MARTINEZ RESPONSE TO TRABECTEDIN UP 7149All SZGR 2.0 genes in this pathway
IVANOVA HEMATOPOIESIS STEM CELL AND PROGENITOR 681420All SZGR 2.0 genes in this pathway
DELACROIX RAR BOUND ES 462273All SZGR 2.0 genes in this pathway
RAO BOUND BY SALL4 ISOFORM B 517302All SZGR 2.0 genes in this pathway
VANOEVELEN MYOGENESIS SIN3A TARGETS 220133All SZGR 2.0 genes in this pathway
LIM MAMMARY STEM CELL DN 428246All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-485-5p563569m8hsa-miR-485-5pAGAGGCUGGCCGUGAUGAAUUC