Summary ?
GeneID57453
SymbolDSCAML1
SynonymsDSCAM2
DescriptionDown syndrome cell adhesion molecule like 1
ReferenceMIM:611782|HGNC:HGNC:14656|Ensembl:ENSG00000177103|HPRD:10921|Vega:OTTHUMG00000167071
Gene typeprotein-coding
Map location11q23
Pascal p-value0.024
Sherlock p-value0.244
Fetal beta0.32
DMG1 (# studies)
eGeneMyers' cis & trans
SupportCompositeSet
Darnell FMRP targets

Gene in Data Sources
Gene set name Method of gene setDescriptionInfo
CV:PGCnpGenome-wide Association StudyGWAS
DMG:Wockner_2014Genome-wide DNA methylation analysisThis dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). 1
GSMA_IGenome scan meta-analysisPsr: 0.006 
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 2 

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

ProbeChromosomePositionNearest geneP (dis)Beta (dis)FDR (dis)Study
cg2707429211117417377DSCAML11.081E-4-0.3350.028DMG:Wockner_2014

@eQTL annotation

SNP IDChromosomePositioneGeneGene Entrez IDpvalueqvalueTSS distanceeQTL type
rs7202866chr1647735029DSCAML1574530.15trans
rs5979884chrX13481807DSCAML1574530.01trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005515protein bindingIEA-
GO:0042803protein homodimerization activityIDA11453658 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0007420brain developmentIDABrain (GO term level: 7)12051741 
GO:0007409axonogenesisNASneuron, axon, neurite (GO term level: 12)11453658 
GO:0001709cell fate determinationNAS12051741 
GO:0007155cell adhesionIEA-
GO:0009953dorsal/ventral pattern formationNAS12051741 
GO:0048704embryonic skeletal system morphogenesisIDA12051741 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0016020membraneIEA-
GO:0016021integral to membraneIEA-
GO:0009986cell surfaceIDA11453658 

Section V. Pathway annotation

Pathway namePathway size# SZGR 2.0 genes in pathwayInfo
REACTOME CELL CELL COMMUNICATION 12077All SZGR 2.0 genes in this pathway
REACTOME DSCAM INTERACTIONS 1110All SZGR 2.0 genes in this pathway
GAUSSMANN MLL AF4 FUSION TARGETS C DN 1911All SZGR 2.0 genes in this pathway
SHETH LIVER CANCER VS TXNIP LOSS PAM4 261153All SZGR 2.0 genes in this pathway
LIU LIVER CANCER 3818All SZGR 2.0 genes in this pathway
BENPORATH SUZ12 TARGETS 1038678All SZGR 2.0 genes in this pathway
BENPORATH EED TARGETS 1062725All SZGR 2.0 genes in this pathway
BENPORATH ES WITH H3K27ME3 1118744All SZGR 2.0 genes in this pathway
BENPORATH PRC2 TARGETS 652441All SZGR 2.0 genes in this pathway
MEISSNER NPC HCP WITH H3K4ME2 AND H3K27ME3 349234All SZGR 2.0 genes in this pathway
MIKKELSEN NPC HCP WITH H3K27ME3 341243All SZGR 2.0 genes in this pathway
MIKKELSEN MEF HCP WITH H3K27ME3 590403All SZGR 2.0 genes in this pathway
GOBERT OLIGODENDROCYTE DIFFERENTIATION DN 1080713All SZGR 2.0 genes in this pathway
GOBERT CORE OLIGODENDROCYTE DIFFERENTIATION 4028All SZGR 2.0 genes in this pathway
ZWANG TRANSIENTLY UP BY 2ND EGF PULSE ONLY 1725838All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-25/32/92/363/3675345411A,m8hsa-miR-25brainCAUUGCACUUGUCUCGGUCUGA
hsa-miR-32UAUUGCACAUUACUAAGUUGC
hsa-miR-92UAUUGCACUUGUCCCGGCCUG
hsa-miR-367AAUUGCACUUUAGCAAUGGUGA
hsa-miR-92bSZUAUUGCACUCGUCCCGGCCUC
miR-3765095161A,m8hsa-miR-376aAUCAUAGAGGAAAAUCCACGU
hsa-miR-376bAUCAUAGAGGAAAAUCCAUGUU
miR-433-3p1331401A,m8hsa-miR-433brainAUCAUGAUGGGCUCCUCGGUGU
miR-493-5p1621681Ahsa-miR-493-5pUUGUACAUGGUAGGCUUUCAUU
miR-494548554m8hsa-miR-494brainUGAAACAUACACGGGAAACCUCUU
miR-539315321m8hsa-miR-539GGAGAAAUUAUCCUUGGUGUGU