Summary ?
GeneID57554
SymbolLRRC7
SynonymsDENSIN
Descriptionleucine rich repeat containing 7
ReferenceMIM:614453|HGNC:HGNC:18531|Ensembl:ENSG00000033122|HPRD:09930|Vega:OTTHUMG00000059194
Gene typeprotein-coding
Map location1p31.1
Pascal p-value0.075
Fetal beta1.613
eGeneMyers' cis & trans
SupportPROTEIN CLUSTERING
G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-CONSENSUS
G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-FULL
G2Cdb.human_BAYES-COLLINS-MOUSE-PSD-CONSENSUS
G2Cdb.humanPSD
G2Cdb.humanPSP
CompositeSet
Darnell FMRP targets
Potential synaptic genes

Gene in Data Sources
Gene set name Method of gene setDescriptionInfo
CV:PGCnpGenome-wide Association StudyGWAS
PMID:cooccurHigh-throughput literature-searchSystematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
GSMA_IIAGenome scan meta-analysis (All samples)Psr: 0.02692 
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: schizophrenia,schizophreniasClick to show details

Section I. Genetics and epigenetics annotation

@eQTL annotation

SNP IDChromosomePositioneGeneGene Entrez IDpvalueqvalueTSS distanceeQTL type
rs4680999chr378613401LRRC7575540.14trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
GenePearson's Correlation Spearman's Correlation
EDC30.950.94
WDR50.950.95
GTF3C20.950.95
KIAA19670.950.95
QRICH10.950.94
LSM14B0.950.95
FAM40A0.950.94
PRCC0.940.94
USP100.940.94
SF10.940.94
Top 10 negatively co-expressed genes
GenePearson's Correlation Spearman's Correlation
MT-CO2-0.83-0.90
AF347015.31-0.82-0.89
AF347015.27-0.80-0.88
AF347015.33-0.80-0.86
MT-CYB-0.79-0.86
FXYD1-0.79-0.87
AF347015.8-0.78-0.88
IFI27-0.77-0.84
C5orf53-0.76-0.77
AF347015.21-0.76-0.92

Section III. Gene Ontology annotation

Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005515protein bindingIPI15767459 |17353931 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005634nucleusIDA18029348 
GO:0005730nucleolusIDA18029348 
GO:0005730nucleolusIDA18029348 
GO:0005737cytoplasmIEA-
GO:0005925focal adhesionIDA18029348 
GO:0005886plasma membraneIDA18029348 

Section V. Pathway annotation

Pathway namePathway size# SZGR 2.0 genes in pathwayInfo
YOSHIMURA MAPK8 TARGETS UP 1305895All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-13389951Ahsa-miR-133aUUGGUCCCCUUCAACCAGCUGU
hsa-miR-133bUUGGUCCCCUUCAACCAGCUA
miR-1853423481Ahsa-miR-185brainUGGAGAGAAAGGCAGUUC
miR-218313319m8hsa-miR-218brainUUGUGCUUGAUCUAACCAUGU
miR-33885911Ahsa-miR-338brainUCCAGCAUCAGUGAUUUUGUUGA
miR-34b357363m8hsa-miR-34bUAGGCAGUGUCAUUAGCUGAUUG
miR-452981041Ahsa-miR-452UGUUUGCAGAGGAAACUGAGAC
miR-485-5p208214m8hsa-miR-485-5pAGAGGCUGGCCGUGAUGAAUUC
miR-539107710841A,m8hsa-miR-539GGAGAAAUUAUCCUUGGUGUGU
miR-5431541601Ahsa-miR-543AAACAUUCGCGGUGCACUUCU