Gene Page: NLGN2
Summary ?
| GeneID | 57555 |
| Symbol | NLGN2 |
| Synonyms | - |
| Description | neuroligin 2 |
| Reference | MIM:606479|HGNC:HGNC:14290|Ensembl:ENSG00000169992|HPRD:07348|Vega:OTTHUMG00000108138 |
| Gene type | protein-coding |
| Map location | 17p13.1 |
| Pascal p-value | 0.02 |
| Sherlock p-value | 0.958 |
| Fetal beta | 0.078 |
| Support | CELL ADHESION AND TRANSSYNAPTIC SIGNALING G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-CONSENSUS G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-FULL G2Cdb.human_BAYES-COLLINS-MOUSE-PSD-CONSENSUS CompositeSet Darnell FMRP targets Potential synaptic genes |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
| Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
| GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 3 |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| PMPCA | 0.87 | 0.84 |
| FARSA | 0.87 | 0.81 |
| STK25 | 0.86 | 0.82 |
| VPS4A | 0.86 | 0.82 |
| DBNL | 0.85 | 0.83 |
| LDOC1 | 0.85 | 0.82 |
| POLR2E | 0.84 | 0.83 |
| ARFIP2 | 0.84 | 0.79 |
| PPP5C | 0.84 | 0.82 |
| TCF25 | 0.84 | 0.79 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| MT-CO2 | -0.70 | -0.60 |
| AF347015.31 | -0.69 | -0.62 |
| AF347015.8 | -0.69 | -0.62 |
| AF347015.2 | -0.69 | -0.61 |
| AF347015.33 | -0.69 | -0.61 |
| MT-CYB | -0.68 | -0.61 |
| AF347015.26 | -0.68 | -0.63 |
| AF347015.21 | -0.68 | -0.59 |
| AF347015.27 | -0.66 | -0.62 |
| AF347015.15 | -0.66 | -0.62 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0042043 | neurexin binding | NAS | Synap (GO term level: 4) | 10892652 |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0007416 | synaptogenesis | NAS | Synap (GO term level: 6) | 10892652 |
| GO:0016337 | cell-cell adhesion | NAS | 10892652 | |
| GO:0045217 | cell-cell junction maintenance | NAS | 10892652 | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0045211 | postsynaptic membrane | NAS | Synap, Neurotransmitter (GO term level: 5) | 10892652 |
| GO:0045202 | synapse | IEA | neuron, Synap, Neurotransmitter, Glial (GO term level: 2) | - |
| GO:0016021 | integral to membrane | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| KEGG CELL ADHESION MOLECULES CAMS | 134 | 93 | All SZGR 2.0 genes in this pathway |
| COLIN PILOCYTIC ASTROCYTOMA VS GLIOBLASTOMA UP | 35 | 32 | All SZGR 2.0 genes in this pathway |
| CUI TCF21 TARGETS 2 UP | 428 | 266 | All SZGR 2.0 genes in this pathway |
| YOSHIMURA MAPK8 TARGETS UP | 1305 | 895 | All SZGR 2.0 genes in this pathway |
| CHEN METABOLIC SYNDROM NETWORK | 1210 | 725 | All SZGR 2.0 genes in this pathway |
| MEISSNER NPC HCP WITH H3 UNMETHYLATED | 536 | 296 | All SZGR 2.0 genes in this pathway |
| MILI PSEUDOPODIA HAPTOTAXIS DN | 668 | 419 | All SZGR 2.0 genes in this pathway |
| MIKKELSEN MEF HCP WITH H3 UNMETHYLATED | 228 | 119 | All SZGR 2.0 genes in this pathway |
| KARLSSON TGFB1 TARGETS DN | 207 | 139 | All SZGR 2.0 genes in this pathway |
| GOBERT OLIGODENDROCYTE DIFFERENTIATION DN | 1080 | 713 | All SZGR 2.0 genes in this pathway |
| LIM MAMMARY STEM CELL UP | 489 | 314 | All SZGR 2.0 genes in this pathway |
| ZWANG TRANSIENTLY UP BY 2ND EGF PULSE ONLY | 1725 | 838 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-182 | 1640 | 1646 | 1A | hsa-miR-182 | UUUGGCAAUGGUAGAACUCACA |
| hsa-miR-182 | UUUGGCAAUGGUAGAACUCACA | ||||
| miR-223 | 1676 | 1682 | 1A | hsa-miR-223 | UGUCAGUUUGUCAAAUACCCC |
| miR-370 | 1493 | 1500 | 1A,m8 | hsa-miR-370brain | GCCUGCUGGGGUGGAACCUGG |
| miR-7 | 1669 | 1676 | 1A,m8 | hsa-miR-7SZ | UGGAAGACUAGUGAUUUUGUUG |
| miR-96 | 1066 | 1073 | 1A,m8 | hsa-miR-96brain | UUUGGCACUAGCACAUUUUUGC |
| hsa-miR-96brain | UUUGGCACUAGCACAUUUUUGC | ||||
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.