Summary ?
GeneID57657
SymbolHCN3
Synonyms-
Descriptionhyperpolarization activated cyclic nucleotide gated potassium channel 3
ReferenceMIM:609973|HGNC:HGNC:19183|Ensembl:ENSG00000143630|HPRD:17093|Vega:OTTHUMG00000035872
Gene typeprotein-coding
Map location1q22
Sherlock p-value0.305
Fetal beta0.915
eGeneCerebellum
Cortex
Myers' cis & trans

Gene in Data Sources
Gene set name Method of gene setDescriptionInfo
CV:PGCnpGenome-wide Association StudyGWAS
PMID:cooccurHigh-throughput literature-searchSystematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
GSMA_IGenome scan meta-analysisPsr: 0.0235 
GSMA_IIAGenome scan meta-analysis (All samples)Psr: 0.00814 
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: schizophrenia,schizophrenics,schizophreniasClick to show details

Section I. Genetics and epigenetics annotation

@eQTL annotation

SNP IDChromosomePositioneGeneGene Entrez IDpvalueqvalueTSS distanceeQTL type
rs6753473chr226526418HCN3576570trans
rs16829545chr2151977407HCN3576574.024E-4trans
rs7584986chr2184111432HCN3576570.09trans
rs17762315chr576807576HCN3576570.07trans
rs7729096chr576835927HCN3576570.17trans
rs4836429chr5128339224HCN3576570.17trans
rs1368303chr5147672388HCN3576570.07trans
rs9296185chr636530602HCN3576570.14trans
rs10119203chr9124813077HCN3576570.18trans
rs17124813chr10110347464HCN3576570.11trans
rs16955618chr1529937543HCN3576573.839E-9trans
rs11873184chr181584081HCN3576570.09trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0000166nucleotide bindingIEA-
GO:0005515protein bindingIEA-
GO:0005244voltage-gated ion channel activityIEA-
GO:0005249voltage-gated potassium channel activityIEA-
GO:0005272sodium channel activityIEA-
GO:0030552cAMP bindingIEA-
GO:0030955potassium ion bindingIEA-
GO:0031402sodium ion bindingIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006814sodium ion transportIEA-
GO:0006811ion transportIEA-
GO:0006813potassium ion transportIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0016020membraneIEA-
GO:0016021integral to membraneIEA-

Section V. Pathway annotation

Pathway namePathway size# SZGR 2.0 genes in pathwayInfo
REACTOME NEURONAL SYSTEM 279221All SZGR 2.0 genes in this pathway
REACTOME POTASSIUM CHANNELS 9868All SZGR 2.0 genes in this pathway
GEORGES TARGETS OF MIR192 AND MIR215 893528All SZGR 2.0 genes in this pathway
NIKOLSKY BREAST CANCER 1Q21 AMPLICON 3818All SZGR 2.0 genes in this pathway
NIKOLSKY MUTATED AND AMPLIFIED IN BREAST CANCER 9460All SZGR 2.0 genes in this pathway
TOYOTA TARGETS OF MIR34B AND MIR34C 463262All SZGR 2.0 genes in this pathway
BRUINS UVC RESPONSE VIA TP53 GROUP B 549316All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-2183703771A,m8hsa-miR-218brainUUGUGCUUGAUCUAACCAUGU
miR-34/4493954021A,m8hsa-miR-34abrainUGGCAGUGUCUUAGCUGGUUGUU
hsa-miR-34cAGGCAGUGUAGUUAGCUGAUUGC
hsa-miR-449UGGCAGUGUAUUGUUAGCUGGU
hsa-miR-449bAGGCAGUGUAUUGUUAGCUGGC