Summary ?
GeneID57687
SymbolVAT1L
Synonyms-
Descriptionvesicle amine transport 1-like
ReferenceHGNC:HGNC:29315|Ensembl:ENSG00000171724|HPRD:13875|Vega:OTTHUMG00000176845
Gene typeprotein-coding
Map location16q23.1
Pascal p-value0.031
Sherlock p-value0.563
Fetal beta-1.062
eGeneMyers' cis & trans

Gene in Data Sources
Gene set name Method of gene setDescriptionInfo
CV:GWAScatGenome-wide Association StudiesThis data set includes 560 SNPs associated with schizophrenia. A total of 486 genes were mapped to these SNPs within 50kb.
CV:GWASdbGenome-wide Association StudiesGWASdb records for schizophrenia
CV:PGCnpGenome-wide Association StudyGWAS
PMID:cooccurHigh-throughput literature-searchSystematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: schizophrenia,schizophreniasClick to show details

Section I. Genetics and epigenetics annotation

@eQTL annotation

SNP IDChromosomePositioneGeneGene Entrez IDpvalueqvalueTSS distanceeQTL type
rs12931172chr1678138089VAT1L576870.08cis

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
GenePearson's Correlation Spearman's Correlation
NDUFB110.940.94
PSMB40.940.95
COPE0.920.91
C12orf570.920.92
EIF60.910.92
FLAD10.910.91
CLPP0.910.91
MRPS340.910.90
RPS27AP110.910.90
DCTN30.910.94
Top 10 negatively co-expressed genes
GenePearson's Correlation Spearman's Correlation
AF347015.26-0.60-0.75
AF347015.15-0.58-0.71
AF347015.8-0.58-0.69
AF347015.27-0.57-0.70
AF347015.2-0.57-0.71
MT-CYB-0.57-0.69
AF347015.33-0.56-0.69
MT-CO2-0.55-0.64
ABCB1-0.55-0.61
MT-ATP8-0.54-0.73

Section III. Gene Ontology annotation

Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005488bindingIEA-
GO:0008270zinc ion bindingIEA-
GO:0016491oxidoreductase activityIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0055114oxidation reductionIEA-

Section V. Pathway annotation

Pathway namePathway size# SZGR 2.0 genes in pathwayInfo
IVANOVA HEMATOPOIESIS STEM CELL 254164All SZGR 2.0 genes in this pathway
WANG SMARCE1 TARGETS UP 280183All SZGR 2.0 genes in this pathway
LEIN MIDBRAIN MARKERS 8255All SZGR 2.0 genes in this pathway
ZHENG GLIOBLASTOMA PLASTICITY UP 250168All SZGR 2.0 genes in this pathway
MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3 1069729All SZGR 2.0 genes in this pathway
MEISSNER NPC HCP WITH H3K4ME2 AND H3K27ME3 349234All SZGR 2.0 genes in this pathway
MIKKELSEN NPC HCP WITH H3K27ME3 341243All SZGR 2.0 genes in this pathway
CHICAS RB1 TARGETS GROWING 243155All SZGR 2.0 genes in this pathway
CHICAS RB1 TARGETS CONFLUENT 567365All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-124.1224522521A,m8hsa-miR-124aUUAAGGCACGCGGUGAAUGCCA
miR-124/506224522511Ahsa-miR-506UAAGGCACCCUUCUGAGUAGA
hsa-miR-124brainUAAGGCACGCGGUGAAUGCC
miR-182152215281Ahsa-miR-182UUUGGCAAUGGUAGAACUCACA
miR-200bc/4291831901A,m8hsa-miR-200bUAAUACUGCCUGGUAAUGAUGAC
hsa-miR-200cUAAUACUGCCGGGUAAUGAUGG
hsa-miR-429UAAUACUGUCUGGUAAAACCGU
miR-2171801871A,m8hsa-miR-217UACUGCAUCAGGAACUGAUUGGAU
miR-30-5p236623731A,m8hsa-miR-30a-5pUGUAAACAUCCUCGACUGGAAG
hsa-miR-30cbrainUGUAAACAUCCUACACUCUCAGC
hsa-miR-30dSZUGUAAACAUCCCCGACUGGAAG
hsa-miR-30bSZUGUAAACAUCCUACACUCAGCU
hsa-miR-30e-5pUGUAAACAUCCUUGACUGGA
miR-96152215281Ahsa-miR-96brainUUUGGCACUAGCACAUUUUUGC
hsa-miR-96brainUUUGGCACUAGCACAUUUUUGC