Gene Page: LRRC4C
Summary ?
| GeneID | 57689 |
| Symbol | LRRC4C |
| Synonyms | NGL-1|NGL1 |
| Description | leucine rich repeat containing 4C |
| Reference | MIM:608817|HGNC:HGNC:29317|Ensembl:ENSG00000148948|HPRD:12303|Vega:OTTHUMG00000166383 |
| Gene type | protein-coding |
| Map location | 11p12 |
| Pascal p-value | 0.017 |
| Fetal beta | -1.641 |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:GWAScat | Genome-wide Association Studies | This data set includes 560 SNPs associated with schizophrenia. A total of 486 genes were mapped to these SNPs within 50kb. | |
| CV:GWASdb | Genome-wide Association Studies | GWASdb records for schizophrenia | |
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| TCAP | 0.85 | 0.59 |
| NPPA | 0.78 | 0.78 |
| C13orf33 | 0.78 | 0.59 |
| CAMK1 | 0.76 | 0.68 |
| CCIN | 0.72 | 0.71 |
| DUSP13 | 0.72 | 0.78 |
| MATK | 0.72 | 0.69 |
| NPBWR1 | 0.71 | 0.70 |
| KIF12 | 0.71 | 0.69 |
| PLCD3 | 0.71 | 0.68 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| AC005035.1 | -0.45 | -0.60 |
| MAP4K4 | -0.43 | -0.58 |
| FAM107B | -0.43 | -0.54 |
| AC005071.3 | -0.39 | -0.52 |
| PHLDB1 | -0.39 | -0.46 |
| LAS1L | -0.39 | -0.55 |
| ZNF652 | -0.39 | -0.53 |
| NEK3 | -0.39 | -0.57 |
| SEMA4B | -0.39 | -0.49 |
| PHKA2 | -0.38 | -0.51 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0005515 | protein binding | IPI | 14595443 | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0050770 | regulation of axonogenesis | IDA | neuron, axon (GO term level: 13) | 14595443 |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0016020 | membrane | IDA | 14595443 | |
| GO:0016021 | integral to membrane | NAS | 14595443 |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| KEGG AXON GUIDANCE | 129 | 103 | All SZGR 2.0 genes in this pathway |
| SENESE HDAC3 TARGETS DN | 536 | 332 | All SZGR 2.0 genes in this pathway |
| KINSEY TARGETS OF EWSR1 FLII FUSION UP | 1278 | 748 | All SZGR 2.0 genes in this pathway |
| FURUKAWA DUSP6 TARGETS PCI35 UP | 74 | 32 | All SZGR 2.0 genes in this pathway |
| STARK PREFRONTAL CORTEX 22Q11 DELETION DN | 517 | 309 | All SZGR 2.0 genes in this pathway |
| RIGGI EWING SARCOMA PROGENITOR UP | 430 | 288 | All SZGR 2.0 genes in this pathway |
| ACEVEDO METHYLATED IN LIVER CANCER DN | 940 | 425 | All SZGR 2.0 genes in this pathway |
| MIKKELSEN IPS ICP WITH H3K27ME3 | 54 | 32 | All SZGR 2.0 genes in this pathway |
| MIKKELSEN NPC ICP WITH H3K4ME3 | 445 | 257 | All SZGR 2.0 genes in this pathway |
| GOBERT OLIGODENDROCYTE DIFFERENTIATION DN | 1080 | 713 | All SZGR 2.0 genes in this pathway |
| DURAND STROMA S UP | 297 | 194 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-129-5p | 90 | 96 | 1A | hsa-miR-129brain | CUUUUUGCGGUCUGGGCUUGC |
| hsa-miR-129-5p | CUUUUUGCGGUCUGGGCUUGCU | ||||
| hsa-miR-129brain | CUUUUUGCGGUCUGGGCUUGC | ||||
| hsa-miR-129-5p | CUUUUUGCGGUCUGGGCUUGCU | ||||
| miR-494 | 85 | 91 | 1A | hsa-miR-494brain | UGAAACAUACACGGGAAACCUCUU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.