Gene Page: PEX19
Summary ?
| GeneID | 5824 |
| Symbol | PEX19 |
| Synonyms | D1S2223E|HK33|PBD12A|PMP1|PMPI|PXF|PXMP1 |
| Description | peroxisomal biogenesis factor 19 |
| Reference | MIM:600279|HGNC:HGNC:9713|Ensembl:ENSG00000162735|HPRD:02610|Vega:OTTHUMG00000033112 |
| Gene type | protein-coding |
| Map location | 1q23.2 |
| Sherlock p-value | 0.006 |
| Fetal beta | -1.145 |
| DMG | 2 (# studies) |
| eGene | Myers' cis & trans |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DMG:Nishioka_2013 | Genome-wide DNA methylation analysis | The authors investigated the methylation profiles of DNA in peripheral blood cells from 18 patients with first-episode schizophrenia (FESZ) and from 15 normal controls. | 2 |
| DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 2 |
| PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
| GSMA_I | Genome scan meta-analysis | Psr: 0.0235 | |
| GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.00814 | |
| Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenias | Click to show details |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
| Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
|---|---|---|---|---|---|---|---|
| cg07586906 | 1 | 160250600 | PEX19 | 1.126E-4 | 0.272 | 0.029 | DMG:Wockner_2014 |
| cg12701576 | 1 | 160254608 | PEX19 | -0.021 | 0.27 | DMG:Nishioka_2013 |
eQTL annotation
| SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
|---|---|---|---|---|---|---|---|---|
| rs3766389 | chr1 | 160517213 | PEX19 | 5824 | 0.15 | cis |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0005515 | protein binding | IPI | 10704444 | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0006625 | protein targeting to peroxisome | IMP | 10704444 | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005737 | cytoplasm | ISS | - | |
| GO:0005777 | peroxisome | IEA | - | |
| GO:0005777 | peroxisome | ISS | - | |
| GO:0005778 | peroxisomal membrane | IDA | 9339377 | |
| GO:0016020 | membrane | IEA | - |
Section IV. Protein-protein interaction annotation
| Interactors | Aliases B | Official full name B | Experimental | Source | PubMed ID |
|---|---|---|---|---|---|
| ABCD1 | ABC42 | ALD | ALDP | AMN | ATP-binding cassette, sub-family D (ALD), member 1 | ALDP interacts with both farnesylated and mutant farnesyl-deficient PEX19. | BIND | 10777694 |
| ABCD1 | ABC42 | ALD | ALDP | AMN | ATP-binding cassette, sub-family D (ALD), member 1 | - | HPRD,BioGRID | 10777694 |11883941 |
| ABCD2 | ABC39 | ALDL1 | ALDR | ALDRP | hALDR | ATP-binding cassette, sub-family D (ALD), member 2 | - | HPRD | 10704444 |10777694 |
| ABCD2 | ABC39 | ALDL1 | ALDR | ALDRP | hALDR | ATP-binding cassette, sub-family D (ALD), member 2 | Reconstituted Complex Two-hybrid | BioGRID | 10777694 |11883941 |
| ABCD2 | ABC39 | ALDL1 | ALDR | ALDRP | hALDR | ATP-binding cassette, sub-family D (ALD), member 2 | ALDRP interacts with both farnesylated and mutant farnesyl-deficient PEX19. | BIND | 10777694 |
| ABCD3 | ABC43 | PMP70 | PXMP1 | ATP-binding cassette, sub-family D (ALD), member 3 | PMP70 interacts with both farnesylated and mutant farnesyl-deficient PEX19. | BIND | 10777694 |
| ABCD3 | ABC43 | PMP70 | PXMP1 | ATP-binding cassette, sub-family D (ALD), member 3 | - | HPRD,BioGRID | 10777694 |11453642 |
| PEX10 | MGC1998 | NALD | RNF69 | peroxisomal biogenesis factor 10 | PEX10 interacts with PEX19. | BIND | 12096124 |
| PEX10 | MGC1998 | NALD | RNF69 | peroxisomal biogenesis factor 10 | - | HPRD,BioGRID | 10704444 |
| PEX11A | MGC119947 | MGC138534 | PEX11-ALPHA | peroxisomal biogenesis factor 11 alpha | - | HPRD | 10704444 |
| PEX11B | PEX11-BETA | peroxisomal biogenesis factor 11 beta | PEX11B interacts with PEX19. | BIND | 12096124 |
| PEX11B | PEX11-BETA | peroxisomal biogenesis factor 11 beta | - | HPRD,BioGRID | 10704444 |
| PEX12 | PAF-3 | peroxisomal biogenesis factor 12 | - | HPRD,BioGRID | 10704444 |
| PEX12 | PAF-3 | peroxisomal biogenesis factor 12 | PEX12 interacts with PEX19. | BIND | 12096124 |
| PEX13 | NALD | ZWS | peroxisomal biogenesis factor 13 | PEX13 interacts with PEX19. | BIND | 12096124 |
| PEX13 | NALD | ZWS | peroxisomal biogenesis factor 13 | - | HPRD,BioGRID | 10704444 |
| PEX14 | MGC12767 | NAPP2 | Pex14p | dJ734G22.2 | peroxisomal biogenesis factor 14 | PEX14 interacts with PEX19. | BIND | 12096124 |
| PEX14 | MGC12767 | NAPP2 | Pex14p | dJ734G22.2 | peroxisomal biogenesis factor 14 | - | HPRD,BioGRID | 10704444 |
| PEX16 | - | peroxisomal biogenesis factor 16 | PEX16 interacts with PEX19. | BIND | 12096124 |
| PEX16 | - | peroxisomal biogenesis factor 16 | - | HPRD,BioGRID | 10704444 |11390669 |
| PEX3 | DKFZp686N14184 | FLJ13531 | TRG18 | peroxisomal biogenesis factor 3 | - | HPRD,BioGRID | 10704444 |
| PEX3 | DKFZp686N14184 | FLJ13531 | TRG18 | peroxisomal biogenesis factor 3 | PEX3 interacts with PEX19. | BIND | 12096124 |
| PMP22 | CMT1A | CMT1E | DSS | GAS-3 | HMSNIA | HNPP | MGC20769 | Sp110 | peripheral myelin protein 22 | - | HPRD | 10704444 |
| PXMP4 | PMP24 | peroxisomal membrane protein 4, 24kDa | - | HPRD | 10704444 |
| SLC25A17 | PMP34 | solute carrier family 25 (mitochondrial carrier; peroxisomal membrane protein, 34kDa), member 17 | - | HPRD,BioGRID | 10704444 |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| KEGG PEROXISOME | 78 | 47 | All SZGR 2.0 genes in this pathway |
| REACTOME ABCA TRANSPORTERS IN LIPID HOMEOSTASIS | 18 | 11 | All SZGR 2.0 genes in this pathway |
| REACTOME ABC FAMILY PROTEINS MEDIATED TRANSPORT | 34 | 21 | All SZGR 2.0 genes in this pathway |
| REACTOME TRANSMEMBRANE TRANSPORT OF SMALL MOLECULES | 413 | 270 | All SZGR 2.0 genes in this pathway |
| IGARASHI ATF4 TARGETS DN | 90 | 65 | All SZGR 2.0 genes in this pathway |
| FULCHER INFLAMMATORY RESPONSE LECTIN VS LPS UP | 579 | 346 | All SZGR 2.0 genes in this pathway |
| SCHLOSSER SERUM RESPONSE DN | 712 | 443 | All SZGR 2.0 genes in this pathway |
| SPIELMAN LYMPHOBLAST EUROPEAN VS ASIAN DN | 584 | 395 | All SZGR 2.0 genes in this pathway |
| NUYTTEN NIPP1 TARGETS DN | 848 | 527 | All SZGR 2.0 genes in this pathway |
| NUYTTEN EZH2 TARGETS DN | 1024 | 594 | All SZGR 2.0 genes in this pathway |
| SHEN SMARCA2 TARGETS UP | 424 | 268 | All SZGR 2.0 genes in this pathway |
| FLECHNER BIOPSY KIDNEY TRANSPLANT REJECTED VS OK DN | 546 | 351 | All SZGR 2.0 genes in this pathway |
| AFFAR YY1 TARGETS UP | 214 | 133 | All SZGR 2.0 genes in this pathway |
| BLALOCK ALZHEIMERS DISEASE DN | 1237 | 837 | All SZGR 2.0 genes in this pathway |
| KAYO CALORIE RESTRICTION MUSCLE DN | 87 | 59 | All SZGR 2.0 genes in this pathway |
| BURTON ADIPOGENESIS 6 | 189 | 112 | All SZGR 2.0 genes in this pathway |
| MARSON BOUND BY E2F4 UNSTIMULATED | 728 | 415 | All SZGR 2.0 genes in this pathway |
| ACEVEDO LIVER CANCER UP | 973 | 570 | All SZGR 2.0 genes in this pathway |
| ACEVEDO LIVER TUMOR VS NORMAL ADJACENT TISSUE UP | 863 | 514 | All SZGR 2.0 genes in this pathway |
| CHNG MULTIPLE MYELOMA HYPERPLOID DN | 28 | 19 | All SZGR 2.0 genes in this pathway |
| WANG TUMOR INVASIVENESS DN | 210 | 128 | All SZGR 2.0 genes in this pathway |
| VANTVEER BREAST CANCER ESR1 UP | 167 | 99 | All SZGR 2.0 genes in this pathway |
| DANG REGULATED BY MYC DN | 253 | 192 | All SZGR 2.0 genes in this pathway |
| KIM ALL DISORDERS CALB1 CORR UP | 548 | 370 | All SZGR 2.0 genes in this pathway |
| VERHAAK GLIOBLASTOMA NEURAL | 129 | 85 | All SZGR 2.0 genes in this pathway |
| CHANGOLKAR H2AFY TARGETS DN | 40 | 26 | All SZGR 2.0 genes in this pathway |
| FORTSCHEGGER PHF8 TARGETS DN | 784 | 464 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-183 | 135 | 142 | 1A,m8 | hsa-miR-183 | UAUGGCACUGGUAGAAUUCACUG |
| miR-205 | 259 | 265 | 1A | hsa-miR-205 | UCCUUCAUUCCACCGGAGUCUG |
| miR-543 | 310 | 316 | 1A | hsa-miR-543 | AAACAUUCGCGGUGCACUUCU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.