Gene Page: BCAT1
Summary ?
GeneID | 586 |
Symbol | BCAT1 |
Synonyms | BCATC|BCT1|ECA39|MECA39|PNAS121|PP18 |
Description | branched chain amino acid transaminase 1 |
Reference | MIM:113520|HGNC:HGNC:976|Ensembl:ENSG00000060982|HPRD:00216|Vega:OTTHUMG00000169053 |
Gene type | protein-coding |
Map location | 12p12.1 |
Pascal p-value | 0.242 |
TADA p-value | 7.44E-4 |
Fetal beta | 0.922 |
Support | CompositeSet |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DNM:Fromer_2014 | Whole Exome Sequencing analysis | This study reported a WES study of 623 schizophrenia trios, reporting DNMs using genomic DNA. | |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 2 |
Section I. Genetics and epigenetics annotation
DNM table
Gene | Chromosome | Position | Ref | Alt | Transcript | AA change | Mutation type | Sift | CG46 | Trait | Study |
---|---|---|---|---|---|---|---|---|---|---|---|
BCAT1 | chr12 | 24989507..24989508 | GT | G | NM_001178091 NM_001178092 NM_001178093 NM_001178094 NM_005504 | . . . . . | frameshift frameshift frameshift frameshift frameshift | Schizophrenia | DNM:Fromer_2014 |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0004084 | branched-chain-amino-acid transaminase activity | IEA | glutamate (GO term level: 6) | - |
GO:0004084 | branched-chain-amino-acid transaminase activity | TAS | glutamate (GO term level: 6) | 6933702 |
GO:0003824 | catalytic activity | IEA | - | |
GO:0016740 | transferase activity | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0000082 | G1/S transition of mitotic cell cycle | TAS | 8692959 | |
GO:0009081 | branched chain family amino acid metabolic process | IEA | - | |
GO:0009082 | branched chain family amino acid biosynthetic process | TAS | 6933702 | |
GO:0008283 | cell proliferation | TAS | 6933702 | |
GO:0008152 | metabolic process | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005737 | cytoplasm | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG VALINE LEUCINE AND ISOLEUCINE DEGRADATION | 44 | 26 | All SZGR 2.0 genes in this pathway |
KEGG VALINE LEUCINE AND ISOLEUCINE BIOSYNTHESIS | 11 | 8 | All SZGR 2.0 genes in this pathway |
KEGG PANTOTHENATE AND COA BIOSYNTHESIS | 16 | 9 | All SZGR 2.0 genes in this pathway |
PID MYC ACTIV PATHWAY | 79 | 62 | All SZGR 2.0 genes in this pathway |
REACTOME METABOLISM OF AMINO ACIDS AND DERIVATIVES | 200 | 136 | All SZGR 2.0 genes in this pathway |
REACTOME BRANCHED CHAIN AMINO ACID CATABOLISM | 17 | 9 | All SZGR 2.0 genes in this pathway |
NAKAMURA CANCER MICROENVIRONMENT DN | 46 | 29 | All SZGR 2.0 genes in this pathway |
KORKOLA EMBRYONAL CARCINOMA UP | 41 | 27 | All SZGR 2.0 genes in this pathway |
IGARASHI ATF4 TARGETS DN | 90 | 65 | All SZGR 2.0 genes in this pathway |
FULCHER INFLAMMATORY RESPONSE LECTIN VS LPS UP | 579 | 346 | All SZGR 2.0 genes in this pathway |
THUM SYSTOLIC HEART FAILURE UP | 423 | 283 | All SZGR 2.0 genes in this pathway |
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP | 1382 | 904 | All SZGR 2.0 genes in this pathway |
CHARAFE BREAST CANCER LUMINAL VS MESENCHYMAL DN | 460 | 312 | All SZGR 2.0 genes in this pathway |
CHARAFE BREAST CANCER BASAL VS MESENCHYMAL DN | 50 | 36 | All SZGR 2.0 genes in this pathway |
VECCHI GASTRIC CANCER ADVANCED VS EARLY UP | 175 | 120 | All SZGR 2.0 genes in this pathway |
SMIRNOV CIRCULATING ENDOTHELIOCYTES IN CANCER UP | 158 | 103 | All SZGR 2.0 genes in this pathway |
MULLIGHAN NPM1 MUTATED SIGNATURE 1 DN | 126 | 86 | All SZGR 2.0 genes in this pathway |
MULLIGHAN MLL SIGNATURE 1 DN | 242 | 165 | All SZGR 2.0 genes in this pathway |
MULLIGHAN MLL SIGNATURE 2 DN | 281 | 186 | All SZGR 2.0 genes in this pathway |
MULLIGHAN NPM1 SIGNATURE 3 DN | 162 | 116 | All SZGR 2.0 genes in this pathway |
TONKS TARGETS OF RUNX1 RUNX1T1 FUSION GRANULOCYTE UP | 55 | 34 | All SZGR 2.0 genes in this pathway |
SENESE HDAC3 TARGETS DN | 536 | 332 | All SZGR 2.0 genes in this pathway |
JAATINEN HEMATOPOIETIC STEM CELL UP | 316 | 190 | All SZGR 2.0 genes in this pathway |
DELYS THYROID CANCER UP | 443 | 294 | All SZGR 2.0 genes in this pathway |
CAIRO PML TARGETS BOUND BY MYC UP | 23 | 17 | All SZGR 2.0 genes in this pathway |
BERENJENO TRANSFORMED BY RHOA UP | 536 | 340 | All SZGR 2.0 genes in this pathway |
HEIDENBLAD AMPLIFIED IN PANCREATIC CANCER | 31 | 19 | All SZGR 2.0 genes in this pathway |
AMUNDSON RESPONSE TO ARSENITE | 217 | 143 | All SZGR 2.0 genes in this pathway |
LIEN BREAST CARCINOMA METAPLASTIC VS DUCTAL UP | 83 | 51 | All SZGR 2.0 genes in this pathway |
GRUETZMANN PANCREATIC CANCER DN | 203 | 134 | All SZGR 2.0 genes in this pathway |
KIM MYCN AMPLIFICATION TARGETS UP | 92 | 64 | All SZGR 2.0 genes in this pathway |
HATADA METHYLATED IN LUNG CANCER UP | 390 | 236 | All SZGR 2.0 genes in this pathway |
PUJANA BRCA1 PCC NETWORK | 1652 | 1023 | All SZGR 2.0 genes in this pathway |
PUJANA ATM PCC NETWORK | 1442 | 892 | All SZGR 2.0 genes in this pathway |
PUJANA CHEK2 PCC NETWORK | 779 | 480 | All SZGR 2.0 genes in this pathway |
LIAO METASTASIS | 539 | 324 | All SZGR 2.0 genes in this pathway |
SCHAEFFER PROSTATE DEVELOPMENT 48HR DN | 428 | 306 | All SZGR 2.0 genes in this pathway |
PASQUALUCCI LYMPHOMA BY GC STAGE DN | 165 | 104 | All SZGR 2.0 genes in this pathway |
BENPORATH NANOG TARGETS | 988 | 594 | All SZGR 2.0 genes in this pathway |
BENPORATH SOX2 TARGETS | 734 | 436 | All SZGR 2.0 genes in this pathway |
MORI EMU MYC LYMPHOMA BY ONSET TIME UP | 110 | 69 | All SZGR 2.0 genes in this pathway |
ASTON MAJOR DEPRESSIVE DISORDER DN | 160 | 110 | All SZGR 2.0 genes in this pathway |
PEART HDAC PROLIFERATION CLUSTER DN | 76 | 57 | All SZGR 2.0 genes in this pathway |
LENAOUR DENDRITIC CELL MATURATION DN | 128 | 90 | All SZGR 2.0 genes in this pathway |
AFFAR YY1 TARGETS DN | 234 | 137 | All SZGR 2.0 genes in this pathway |
HESS TARGETS OF HOXA9 AND MEIS1 UP | 65 | 44 | All SZGR 2.0 genes in this pathway |
YAGI AML SURVIVAL | 129 | 87 | All SZGR 2.0 genes in this pathway |
BURTON ADIPOGENESIS 2 | 72 | 52 | All SZGR 2.0 genes in this pathway |
MCCLUNG CREB1 TARGETS UP | 100 | 72 | All SZGR 2.0 genes in this pathway |
WANG SMARCE1 TARGETS UP | 280 | 183 | All SZGR 2.0 genes in this pathway |
MONNIER POSTRADIATION TUMOR ESCAPE UP | 393 | 244 | All SZGR 2.0 genes in this pathway |
CREIGHTON ENDOCRINE THERAPY RESISTANCE 3 | 720 | 440 | All SZGR 2.0 genes in this pathway |
LEIN MIDBRAIN MARKERS | 82 | 55 | All SZGR 2.0 genes in this pathway |
WHITEFORD PEDIATRIC CANCER MARKERS | 116 | 63 | All SZGR 2.0 genes in this pathway |
BLUM RESPONSE TO SALIRASIB UP | 245 | 159 | All SZGR 2.0 genes in this pathway |
LEE LIVER CANCER SURVIVAL DN | 175 | 103 | All SZGR 2.0 genes in this pathway |
BOYLAN MULTIPLE MYELOMA C D UP | 139 | 95 | All SZGR 2.0 genes in this pathway |
RUTELLA RESPONSE TO CSF2RB AND IL4 DN | 315 | 201 | All SZGR 2.0 genes in this pathway |
RUTELLA RESPONSE TO HGF UP | 418 | 282 | All SZGR 2.0 genes in this pathway |
RUTELLA RESPONSE TO HGF VS CSF2RB AND IL4 UP | 408 | 276 | All SZGR 2.0 genes in this pathway |
COLINA TARGETS OF 4EBP1 AND 4EBP2 | 356 | 214 | All SZGR 2.0 genes in this pathway |
MEISSNER NPC HCP WITH H3 UNMETHYLATED | 536 | 296 | All SZGR 2.0 genes in this pathway |
POOLA INVASIVE BREAST CANCER UP | 288 | 168 | All SZGR 2.0 genes in this pathway |
CHIANG LIVER CANCER SUBCLASS PROLIFERATION UP | 178 | 108 | All SZGR 2.0 genes in this pathway |
TSAI DNAJB4 TARGETS DN | 6 | 6 | All SZGR 2.0 genes in this pathway |
GYORFFY DOXORUBICIN RESISTANCE | 56 | 34 | All SZGR 2.0 genes in this pathway |
KORKOLA EMBRYONIC CARCINOMA VS SEMINOMA UP | 22 | 15 | All SZGR 2.0 genes in this pathway |
DANG MYC TARGETS UP | 143 | 100 | All SZGR 2.0 genes in this pathway |
DANG BOUND BY MYC | 1103 | 714 | All SZGR 2.0 genes in this pathway |
WONG EMBRYONIC STEM CELL CORE | 335 | 193 | All SZGR 2.0 genes in this pathway |
YAO TEMPORAL RESPONSE TO PROGESTERONE CLUSTER 8 | 49 | 36 | All SZGR 2.0 genes in this pathway |
KARLSSON TGFB1 TARGETS UP | 127 | 78 | All SZGR 2.0 genes in this pathway |
JOHNSTONE PARVB TARGETS 3 DN | 918 | 550 | All SZGR 2.0 genes in this pathway |
LEE BMP2 TARGETS UP | 745 | 475 | All SZGR 2.0 genes in this pathway |
KOINUMA TARGETS OF SMAD2 OR SMAD3 | 824 | 528 | All SZGR 2.0 genes in this pathway |
FORTSCHEGGER PHF8 TARGETS DN | 784 | 464 | All SZGR 2.0 genes in this pathway |
RAO BOUND BY SALL4 | 227 | 149 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-124/506 | 671 | 678 | 1A,m8 | hsa-miR-506 | UAAGGCACCCUUCUGAGUAGA |
hsa-miR-124brain | UAAGGCACGCGGUGAAUGCC | ||||
miR-155 | 2573 | 2579 | m8 | hsa-miR-155 | UUAAUGCUAAUCGUGAUAGGGG |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.