Summary ?
GeneID5899
SymbolRALB
Synonyms-
Descriptionv-ral simian leukemia viral oncogene homolog B
ReferenceMIM:179551|HGNC:HGNC:9840|Ensembl:ENSG00000144118|HPRD:01550|Vega:OTTHUMG00000131435
Gene typeprotein-coding
Map location2q14.2
Pascal p-value0.122
DEG p-valueDEG:Zhao_2015:p=5.18e-05:q=0.0489
Fetal beta-0.837
DMG1 (# studies)
eGeneMyers' cis & trans
Meta

Gene in Data Sources
Gene set name Method of gene setDescriptionInfo
CV:PGCnpGenome-wide Association StudyGWAS
DEG:Zhao_2015RNA Sequencing analysisTranscriptome sequencing and genome-wide association analyses reveal lysosomal function and actin cytoskeleton remodeling in schizophrenia and bipolar disorder.
DMG:Jaffe_2016Genome-wide DNA methylation analysisThis dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. 1
GSMA_IGenome scan meta-analysisPsr: 0.023 
GSMA_IIAGenome scan meta-analysis (All samples)Psr: 0.00755 
ExpressionMeta-analysis of gene expressionP value: 1.457 

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

ProbeChromosomePositionNearest geneP (dis)Beta (dis)FDR (dis)Study
cg171696132121010068RALB2.26E-8-0.0127.55E-6DMG:Jaffe_2016

@eQTL annotation

SNP IDChromosomePositioneGeneGene Entrez IDpvalueqvalueTSS distanceeQTL type
rs1578978chr8118196802RALB58990.1trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
GenePearson's Correlation Spearman's Correlation
VPS450.860.85
SMU10.850.82
C15orf440.840.81
ANAPC70.840.81
ALDH3A20.840.81
MBIP0.830.82
CNBP0.830.79
EIF2AK10.830.76
SNX20.830.79
ZC3H140.820.79
Top 10 negatively co-expressed genes
GenePearson's Correlation Spearman's Correlation
AF347015.21-0.75-0.63
MT-CO2-0.73-0.66
AF347015.8-0.71-0.65
AF347015.31-0.70-0.65
MT-CYB-0.69-0.63
AF347015.2-0.68-0.63
IFI27-0.67-0.64
AF347015.27-0.67-0.63
AF347015.15-0.66-0.64
AF347015.33-0.66-0.60

Section III. Gene Ontology annotation

Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0000166nucleotide bindingIEA-
GO:0005515protein bindingIPI7673236 
GO:0005525GTP bindingIEA-
GO:0005525GTP bindingTAS2120779 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0007265Ras protein signal transductionEXP11520933 
GO:0007264small GTPase mediated signal transductionIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005622intracellularIEA-
GO:0005886plasma membraneIEA-

Section V. Pathway annotation

Pathway namePathway size# SZGR 2.0 genes in pathwayInfo
KEGG PATHWAYS IN CANCER 328259All SZGR 2.0 genes in this pathway
KEGG PANCREATIC CANCER 7056All SZGR 2.0 genes in this pathway
PID P38 ALPHA BETA PATHWAY 3125All SZGR 2.0 genes in this pathway
PID CXCR4 PATHWAY 10278All SZGR 2.0 genes in this pathway
PID FOXO PATHWAY 4943All SZGR 2.0 genes in this pathway
REACTOME SIGNALLING BY NGF 217167All SZGR 2.0 genes in this pathway
REACTOME SIGNALLING TO RAS 2723All SZGR 2.0 genes in this pathway
REACTOME NGF SIGNALLING VIA TRKA FROM THE PLASMA MEMBRANE 137105All SZGR 2.0 genes in this pathway
REACTOME SIGNALLING TO ERKS 3630All SZGR 2.0 genes in this pathway
REACTOME P38MAPK EVENTS 1312All SZGR 2.0 genes in this pathway
THUM SYSTOLIC HEART FAILURE UP 423283All SZGR 2.0 genes in this pathway
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP 1382904All SZGR 2.0 genes in this pathway
CHARAFE BREAST CANCER LUMINAL VS BASAL DN 455304All SZGR 2.0 genes in this pathway
ENK UV RESPONSE EPIDERMIS UP 293179All SZGR 2.0 genes in this pathway
WANG BARRETTS ESOPHAGUS UP 5127All SZGR 2.0 genes in this pathway
LINDGREN BLADDER CANCER CLUSTER 2B 392251All SZGR 2.0 genes in this pathway
GRUETZMANN PANCREATIC CANCER UP 358245All SZGR 2.0 genes in this pathway
SPIELMAN LYMPHOBLAST EUROPEAN VS ASIAN DN 584395All SZGR 2.0 genes in this pathway
ALCALA APOPTOSIS 8860All SZGR 2.0 genes in this pathway
SHEN SMARCA2 TARGETS UP 424268All SZGR 2.0 genes in this pathway
LEE LIVER CANCER MYC UP 5430All SZGR 2.0 genes in this pathway
LEE LIVER CANCER MYC TGFA UP 6140All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE DN 1237837All SZGR 2.0 genes in this pathway
CUI TCF21 TARGETS 2 DN 830547All SZGR 2.0 genes in this pathway
KAYO AGING MUSCLE UP 244165All SZGR 2.0 genes in this pathway
DAZARD RESPONSE TO UV SCC UP 12375All SZGR 2.0 genes in this pathway
DOUGLAS BMI1 TARGETS UP 566371All SZGR 2.0 genes in this pathway
DURCHDEWALD SKIN CARCINOGENESIS DN 264168All SZGR 2.0 genes in this pathway
YAGI AML WITH T 8 21 TRANSLOCATION 368247All SZGR 2.0 genes in this pathway
OKAMOTO LIVER CANCER MULTICENTRIC OCCURRENCE UP 2515All SZGR 2.0 genes in this pathway
HOSHIDA LIVER CANCER SUBCLASS S1 237159All SZGR 2.0 genes in this pathway
CHYLA CBFA2T3 TARGETS UP 387225All SZGR 2.0 genes in this pathway
PILON KLF1 TARGETS DN 19721213All SZGR 2.0 genes in this pathway
TORCHIA TARGETS OF EWSR1 FLI1 FUSION DN 321200All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-203.1128012871A,m8hsa-miR-203UGAAAUGUUUAGGACCACUAG
miR-9140314091Ahsa-miR-9SZUCUUUGGUUAUCUAGCUGUAUGA