Gene Page: RAP2A
Summary ?
GeneID | 5911 |
Symbol | RAP2A |
Synonyms | K-REV|KREV|RAP2|RbBP-30 |
Description | RAP2A, member of RAS oncogene family |
Reference | MIM:179540|HGNC:HGNC:9861|HPRD:01547| |
Gene type | protein-coding |
Map location | 13q34 |
Pascal p-value | 0.04 |
Sherlock p-value | 0.5 |
Fetal beta | 0.081 |
DMG | 1 (# studies) |
Support | INTRACELLULAR SIGNAL TRANSDUCTION G2Cdb.humanNRC G2Cdb.humanPSP Potential synaptic genes |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Jaffe_2016 | Genome-wide DNA methylation analysis | This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. | 1 |
Network | Shortest path distance of core genes in the Human protein-protein interaction network | Contribution to shortest path in PPI network: 0.0384 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg25329939 | 13 | 98085947 | RAP2A | 6.57E-9 | -0.013 | 3.39E-6 | DMG:Jaffe_2016 |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0000166 | nucleotide binding | IEA | - | |
GO:0003924 | GTPase activity | TAS | 1900290 | |
GO:0005525 | GTP binding | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0007165 | signal transduction | TAS | 3045729 | |
GO:0007264 | small GTPase mediated signal transduction | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005622 | intracellular | IEA | - | |
GO:0005886 | plasma membrane | IEA | - |
Section IV. Protein-protein interaction annotation
Interactors | Aliases B | Official full name B | Experimental | Source | PubMed ID |
---|---|---|---|---|---|
ARHGAP29 | PARG1 | RP11-255E17.1 | Rho GTPase activating protein 29 | PARG1 interacts with Rap2. | BIND | 15752761 |
GABARAPL2 | ATG8 | GATE-16 | GATE16 | GEF-2 | GEF2 | GABA(A) receptor-associated protein-like 2 | Biochemical Activity | BioGRID | 12581858 |
GRIN1 | NMDA1 | NMDAR1 | NR1 | glutamate receptor, ionotropic, N-methyl D-aspartate 1 | - | HPRD | 10862698 |
MLLT4 | AF-6 | AF6 | AFADIN | FLJ34371 | RP3-431P23.3 | myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4 | - | HPRD | 10224125 |
RAF1 | CRAF | NS5 | Raf-1 | c-Raf | v-raf-1 murine leukemia viral oncogene homolog 1 | Raf-1 interacts with Rap2. This interaction was modeled on a demonstrated interaction between Raf-1 from unspecified species and human Rap2. | BIND | 15752761 |
RALA | MGC48949 | RAL | v-ral simian leukemia viral oncogene homolog A (ras related) | Two-hybrid | BioGRID | 11786539 |
RALGDS | FLJ20922 | RGF | RalGEF | ral guanine nucleotide dissociation stimulator | - | HPRD,BioGRID | 10085114 |
RAPGEF3 | CAMP-GEFI | EPAC | EPAC1 | HSU79275 | MGC21410 | bcm910 | Rap guanine nucleotide exchange factor (GEF) 3 | Biochemical Activity | BioGRID | 10777494 |
RAPGEF4 | CAMP-GEFII | CGEF2 | EPAC2 | Nbla00496 | Rap guanine nucleotide exchange factor (GEF) 4 | Biochemical Activity | BioGRID | 10777494 |
RAPGEF5 | GFR | KIAA0277 | MR-GEF | REPAC | Rap guanine nucleotide exchange factor (GEF) 5 | Biochemical Activity | BioGRID | 10777494 |
RAPGEF6 | DKFZp667N084 | DKFZp686I15116 | KIA001LB | PDZ-GEF2 | PDZGEF2 | RA-GEF-2 | Rap guanine nucleotide exchange factor (GEF) 6 | - | HPRD,BioGRID | 11524421 |12581858 |
RASIP1 | FLJ20401 | RAIN | Ras interacting protein 1 | - | HPRD | 15031288 |
RASSF5 | MGC10823 | MGC17344 | Maxp1 | NORE1 | NORE1A | NORE1B | RAPL | RASSF3 | Ras association (RalGDS/AF-6) domain family member 5 | - | HPRD,BioGRID | 11857081 |
RGS14 | - | regulator of G-protein signaling 14 | - | HPRD,BioGRID | 10926822 |
RUNDC3A | RAP2IP | RPIP8 | RUN domain containing 3A | - | HPRD,BioGRID | 9523700 |
TNIK | - | TRAF2 and NCK interacting kinase | - | HPRD | 15342639 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
SENGUPTA NASOPHARYNGEAL CARCINOMA WITH LMP1 UP | 408 | 247 | All SZGR 2.0 genes in this pathway |
FULCHER INFLAMMATORY RESPONSE LECTIN VS LPS UP | 579 | 346 | All SZGR 2.0 genes in this pathway |
HOOI ST7 TARGETS DN | 123 | 78 | All SZGR 2.0 genes in this pathway |
OSMAN BLADDER CANCER UP | 404 | 246 | All SZGR 2.0 genes in this pathway |
TAKEDA TARGETS OF NUP98 HOXA9 FUSION 8D DN | 205 | 127 | All SZGR 2.0 genes in this pathway |
MULLIGHAN NPM1 MUTATED SIGNATURE 1 UP | 276 | 165 | All SZGR 2.0 genes in this pathway |
PROVENZANI METASTASIS UP | 194 | 112 | All SZGR 2.0 genes in this pathway |
GRAESSMANN APOPTOSIS BY DOXORUBICIN UP | 1142 | 669 | All SZGR 2.0 genes in this pathway |
GRAESSMANN RESPONSE TO MC AND DOXORUBICIN UP | 612 | 367 | All SZGR 2.0 genes in this pathway |
PATIL LIVER CANCER | 747 | 453 | All SZGR 2.0 genes in this pathway |
MARTORIATI MDM4 TARGETS FETAL LIVER UP | 227 | 137 | All SZGR 2.0 genes in this pathway |
NUYTTEN NIPP1 TARGETS DN | 848 | 527 | All SZGR 2.0 genes in this pathway |
NUYTTEN EZH2 TARGETS DN | 1024 | 594 | All SZGR 2.0 genes in this pathway |
XU RESPONSE TO TRETINOIN DN | 13 | 8 | All SZGR 2.0 genes in this pathway |
VERHAAK AML WITH NPM1 MUTATED DN | 246 | 180 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 20HR UP | 240 | 152 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 16HR UP | 225 | 139 | All SZGR 2.0 genes in this pathway |
LU AGING BRAIN DN | 153 | 120 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 8HR UP | 105 | 73 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 48HR DN | 504 | 323 | All SZGR 2.0 genes in this pathway |
IVANOVA HEMATOPOIESIS STEM CELL AND PROGENITOR | 681 | 420 | All SZGR 2.0 genes in this pathway |
KRIGE RESPONSE TO TOSEDOSTAT 6HR UP | 953 | 554 | All SZGR 2.0 genes in this pathway |
KRIGE RESPONSE TO TOSEDOSTAT 24HR UP | 783 | 442 | All SZGR 2.0 genes in this pathway |
RIZKI TUMOR INVASIVENESS 3D DN | 270 | 181 | All SZGR 2.0 genes in this pathway |
FUJII YBX1 TARGETS DN | 202 | 132 | All SZGR 2.0 genes in this pathway |
ACEVEDO LIVER CANCER UP | 973 | 570 | All SZGR 2.0 genes in this pathway |
ACEVEDO LIVER TUMOR VS NORMAL ADJACENT TISSUE UP | 863 | 514 | All SZGR 2.0 genes in this pathway |
MITSIADES RESPONSE TO APLIDIN DN | 249 | 165 | All SZGR 2.0 genes in this pathway |
SHEDDEN LUNG CANCER GOOD SURVIVAL A12 | 317 | 177 | All SZGR 2.0 genes in this pathway |
COLINA TARGETS OF 4EBP1 AND 4EBP2 | 356 | 214 | All SZGR 2.0 genes in this pathway |
VALK AML CLUSTER 3 | 33 | 12 | All SZGR 2.0 genes in this pathway |
BOYAULT LIVER CANCER SUBCLASS G12 UP | 39 | 17 | All SZGR 2.0 genes in this pathway |
SYED ESTRADIOL RESPONSE | 19 | 15 | All SZGR 2.0 genes in this pathway |
CAIRO HEPATOBLASTOMA UP | 207 | 143 | All SZGR 2.0 genes in this pathway |
VERHAAK GLIOBLASTOMA PRONEURAL | 177 | 132 | All SZGR 2.0 genes in this pathway |
HIRSCH CELLULAR TRANSFORMATION SIGNATURE DN | 103 | 67 | All SZGR 2.0 genes in this pathway |
PILON KLF1 TARGETS DN | 1972 | 1213 | All SZGR 2.0 genes in this pathway |
JOHNSTONE PARVB TARGETS 3 DN | 918 | 550 | All SZGR 2.0 genes in this pathway |
GOBERT OLIGODENDROCYTE DIFFERENTIATION DN | 1080 | 713 | All SZGR 2.0 genes in this pathway |
KRIEG HYPOXIA NOT VIA KDM3A | 770 | 480 | All SZGR 2.0 genes in this pathway |
FORTSCHEGGER PHF8 TARGETS DN | 784 | 464 | All SZGR 2.0 genes in this pathway |
RATTENBACHER BOUND BY CELF1 | 467 | 251 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-10 | 251 | 257 | m8 | hsa-miR-10a | UACCCUGUAGAUCCGAAUUUGUG |
hsa-miR-10b | UACCCUGUAGAACCGAAUUUGU | ||||
miR-124.1 | 2638 | 2645 | 1A,m8 | hsa-miR-124a | UUAAGGCACGCGGUGAAUGCCA |
miR-124/506 | 2638 | 2644 | 1A | hsa-miR-506 | UAAGGCACCCUUCUGAGUAGA |
hsa-miR-124brain | UAAGGCACGCGGUGAAUGCC | ||||
miR-135 | 885 | 891 | m8 | hsa-miR-135a | UAUGGCUUUUUAUUCCUAUGUGA |
hsa-miR-135b | UAUGGCUUUUCAUUCCUAUGUG | ||||
miR-186 | 2678 | 2684 | 1A | hsa-miR-186 | CAAAGAAUUCUCCUUUUGGGCUU |
miR-203.1 | 3450 | 3457 | 1A,m8 | hsa-miR-203 | UGAAAUGUUUAGGACCACUAG |
miR-223 | 3388 | 3394 | m8 | hsa-miR-223 | UGUCAGUUUGUCAAAUACCCC |
miR-320 | 1056 | 1062 | 1A | hsa-miR-320 | AAAAGCUGGGUUGAGAGGGCGAA |
hsa-miR-320 | AAAAGCUGGGUUGAGAGGGCGAA | ||||
miR-326 | 3347 | 3354 | 1A,m8 | hsa-miR-326 | CCUCUGGGCCCUUCCUCCAG |
miR-33 | 3485 | 3492 | 1A,m8 | hsa-miR-33 | GUGCAUUGUAGUUGCAUUG |
hsa-miR-33b | GUGCAUUGCUGUUGCAUUGCA | ||||
miR-330 | 2892 | 2899 | 1A,m8 | hsa-miR-330brain | GCAAAGCACACGGCCUGCAGAGA |
miR-9 | 2663 | 2669 | 1A | hsa-miR-9SZ | UCUUUGGUUAUCUAGCUGUAUGA |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.