Gene Page: RARG
Summary ?
GeneID | 5916 |
Symbol | RARG |
Synonyms | NR1B3|RARC |
Description | retinoic acid receptor gamma |
Reference | MIM:180190|HGNC:HGNC:9866|Ensembl:ENSG00000172819|HPRD:01573|Vega:OTTHUMG00000048077 |
Gene type | protein-coding |
Map location | 12q13 |
Pascal p-value | 0.013 |
TADA p-value | 0.001 |
Fetal beta | -1.111 |
DMG | 1 (# studies) |
eGene | Myers' cis & trans Meta |
Support | CompositeSet |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 1 |
DNM:Xu_2012 | Whole Exome Sequencing analysis | De novo mutations of 4 genes were identified by exome sequencing of 795 samples in this study |
Section I. Genetics and epigenetics annotation
DNM table
Gene | Chromosome | Position | Ref | Alt | Transcript | AA change | Mutation type | Sift | CG46 | Trait | Study |
---|---|---|---|---|---|---|---|---|---|---|---|
RARG | chr12 | 53608241 | T | A | NM_000966 NM_001042728 NM_001243730 NM_001243731 NM_001243732 | p.209K>* p.198K>* p.137K>* p.88K>* p.187K>* | nonsense nonsense nonsense nonsense nonsense | Schizophrenia | DNM:Xu_2012 |
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg27364319 | 12 | 53626837 | RARG | 9.92E-5 | -0.378 | 0.028 | DMG:Wockner_2014 |
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs16955618 | chr15 | 29937543 | RARG | 5916 | 0.14 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
PDE6C | 0.50 | 0.29 |
TAS2R4 | 0.50 | 0.41 |
CILP | 0.50 | 0.44 |
TAS2R48 | 0.50 | 0.43 |
NAT8 | 0.49 | 0.39 |
TGM1 | 0.48 | 0.41 |
PLA2G4B | 0.48 | 0.39 |
MST1R | 0.48 | 0.42 |
AC034236.3 | 0.47 | 0.36 |
SLC4A5 | 0.47 | 0.45 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
IFI27 | -0.28 | -0.37 |
RRAS | -0.28 | -0.37 |
ITM2A | -0.28 | -0.35 |
GNG11 | -0.27 | -0.38 |
ABCG2 | -0.27 | -0.36 |
RP11-884K10.1 | -0.27 | -0.36 |
TM4SF18 | -0.27 | -0.33 |
MT-CO2 | -0.26 | -0.34 |
C1orf64 | -0.26 | -0.28 |
S100A4 | -0.26 | -0.35 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0003700 | transcription factor activity | IEA | - | |
GO:0003707 | steroid hormone receptor activity | IEA | - | |
GO:0003708 | retinoic acid receptor activity | TAS | 2157970 | |
GO:0005515 | protein binding | IPI | 10428834 | |
GO:0008270 | zinc ion binding | IEA | - | |
GO:0046872 | metal ion binding | IEA | - | |
GO:0046965 | retinoid X receptor binding | ISS | - | |
GO:0043565 | sequence-specific DNA binding | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0000122 | negative regulation of transcription from RNA polymerase II promoter | ISS | - | |
GO:0006355 | regulation of transcription, DNA-dependent | IEA | - | |
GO:0006350 | transcription | IEA | - | |
GO:0008285 | negative regulation of cell proliferation | ISS | - | |
GO:0008361 | regulation of cell size | TAS | 18438858 | |
GO:0048048 | embryonic eye morphogenesis | IEA | - | |
GO:0007275 | multicellular organismal development | TAS | 2157970 | |
GO:0043065 | positive regulation of apoptosis | IEA | - | |
GO:0048384 | retinoic acid receptor signaling pathway | IDA | 17943189 | |
GO:0032526 | response to retinoic acid | IDA | 17943189 | |
GO:0035116 | embryonic hindlimb morphogenesis | ISS | - | |
GO:0045944 | positive regulation of transcription from RNA polymerase II promoter | IEA | - | |
GO:0060070 | Wnt receptor signaling pathway through beta-catenin | TAS | 18484682 | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005634 | nucleus | IEA | - | |
GO:0005667 | transcription factor complex | IEA | - | |
GO:0016021 | integral to membrane | NAS | 17943189 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
PID RXR VDR PATHWAY | 26 | 24 | All SZGR 2.0 genes in this pathway |
PID RETINOIC ACID PATHWAY | 30 | 23 | All SZGR 2.0 genes in this pathway |
REACTOME GENERIC TRANSCRIPTION PATHWAY | 352 | 181 | All SZGR 2.0 genes in this pathway |
REACTOME NUCLEAR RECEPTOR TRANSCRIPTION PATHWAY | 49 | 36 | All SZGR 2.0 genes in this pathway |
THUM SYSTOLIC HEART FAILURE UP | 423 | 283 | All SZGR 2.0 genes in this pathway |
WANG BARRETTS ESOPHAGUS AND ESOPHAGUS CANCER DN | 37 | 22 | All SZGR 2.0 genes in this pathway |
ZIRN TRETINOIN RESPONSE UP | 21 | 13 | All SZGR 2.0 genes in this pathway |
AMUNDSON GENOTOXIC SIGNATURE | 105 | 68 | All SZGR 2.0 genes in this pathway |
LI WILMS TUMOR VS FETAL KIDNEY 2 DN | 51 | 42 | All SZGR 2.0 genes in this pathway |
KIM MYCN AMPLIFICATION TARGETS UP | 92 | 64 | All SZGR 2.0 genes in this pathway |
SHETH LIVER CANCER VS TXNIP LOSS PAM1 | 229 | 137 | All SZGR 2.0 genes in this pathway |
SHIN B CELL LYMPHOMA CLUSTER 7 | 27 | 22 | All SZGR 2.0 genes in this pathway |
HOFMANN CELL LYMPHOMA DN | 39 | 29 | All SZGR 2.0 genes in this pathway |
MURAKAMI UV RESPONSE 6HR DN | 21 | 13 | All SZGR 2.0 genes in this pathway |
SARTIPY BLUNTED BY INSULIN RESISTANCE DN | 18 | 14 | All SZGR 2.0 genes in this pathway |
MURAKAMI UV RESPONSE 24HR | 20 | 13 | All SZGR 2.0 genes in this pathway |
MARTINEZ RB1 TARGETS UP | 673 | 430 | All SZGR 2.0 genes in this pathway |
MARTINEZ TP53 TARGETS DN | 593 | 372 | All SZGR 2.0 genes in this pathway |
MARTINEZ RB1 AND TP53 TARGETS DN | 591 | 366 | All SZGR 2.0 genes in this pathway |
MCCABE BOUND BY HOXC6 | 469 | 239 | All SZGR 2.0 genes in this pathway |
BONOME OVARIAN CANCER SURVIVAL SUBOPTIMAL DEBULKING | 510 | 309 | All SZGR 2.0 genes in this pathway |
MATTHEWS SKIN CARCINOGENESIS VIA JUN | 17 | 10 | All SZGR 2.0 genes in this pathway |
PARK TRETINOIN RESPONSE AND PML RARA FUSION | 30 | 21 | All SZGR 2.0 genes in this pathway |
AGUIRRE PANCREATIC CANCER COPY NUMBER DN | 238 | 145 | All SZGR 2.0 genes in this pathway |
HAN SATB1 TARGETS UP | 395 | 249 | All SZGR 2.0 genes in this pathway |
HAN SATB1 TARGETS DN | 442 | 275 | All SZGR 2.0 genes in this pathway |
MEISSNER NPC HCP WITH H3 UNMETHYLATED | 536 | 296 | All SZGR 2.0 genes in this pathway |
YAMASHITA LIVER CANCER STEM CELL UP | 47 | 38 | All SZGR 2.0 genes in this pathway |
YAMASHITA LIVER CANCER STEM CELL DN | 76 | 51 | All SZGR 2.0 genes in this pathway |
BHAT ESR1 TARGETS VIA AKT1 DN | 82 | 51 | All SZGR 2.0 genes in this pathway |
WANG NFKB TARGETS | 25 | 15 | All SZGR 2.0 genes in this pathway |
DELACROIX RARG BOUND MEF | 367 | 231 | All SZGR 2.0 genes in this pathway |
FOSTER KDM1A TARGETS DN | 211 | 119 | All SZGR 2.0 genes in this pathway |
ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY | 1839 | 928 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-124/506 | 657 | 663 | m8 | hsa-miR-506 | UAAGGCACCCUUCUGAGUAGA |
hsa-miR-124brain | UAAGGCACGCGGUGAAUGCC | ||||
hsa-miR-506 | UAAGGCACCCUUCUGAGUAGA | ||||
hsa-miR-124brain | UAAGGCACGCGGUGAAUGCC | ||||
miR-142-3p | 711 | 718 | 1A,m8 | hsa-miR-142-3p | UGUAGUGUUUCCUACUUUAUGGA |
miR-182 | 132 | 139 | 1A,m8 | hsa-miR-182 | UUUGGCAAUGGUAGAACUCACA |
hsa-miR-182 | UUUGGCAAUGGUAGAACUCACA | ||||
miR-24 | 410 | 416 | m8 | hsa-miR-24SZ | UGGCUCAGUUCAGCAGGAACAG |
miR-30-5p | 1028 | 1035 | 1A,m8 | hsa-miR-30a-5p | UGUAAACAUCCUCGACUGGAAG |
hsa-miR-30cbrain | UGUAAACAUCCUACACUCUCAGC | ||||
hsa-miR-30dSZ | UGUAAACAUCCCCGACUGGAAG | ||||
hsa-miR-30bSZ | UGUAAACAUCCUACACUCAGCU | ||||
hsa-miR-30e-5p | UGUAAACAUCCUUGACUGGA | ||||
hsa-miR-30a-5p | UGUAAACAUCCUCGACUGGAAG | ||||
hsa-miR-30cbrain | UGUAAACAUCCUACACUCUCAGC | ||||
hsa-miR-30dSZ | UGUAAACAUCCCCGACUGGAAG | ||||
hsa-miR-30bSZ | UGUAAACAUCCUACACUCAGCU | ||||
hsa-miR-30e-5p | UGUAAACAUCCUUGACUGGA | ||||
miR-326 | 822 | 828 | m8 | hsa-miR-326 | CCUCUGGGCCCUUCCUCCAG |
miR-331 | 884 | 890 | m8 | hsa-miR-331brain | GCCCCUGGGCCUAUCCUAGAA |
miR-34/449 | 273 | 279 | m8 | hsa-miR-34abrain | UGGCAGUGUCUUAGCUGGUUGUU |
hsa-miR-34c | AGGCAGUGUAGUUAGCUGAUUGC | ||||
hsa-miR-449 | UGGCAGUGUAUUGUUAGCUGGU | ||||
hsa-miR-449b | AGGCAGUGUAUUGUUAGCUGGC | ||||
miR-96 | 133 | 139 | 1A | hsa-miR-96brain | UUUGGCACUAGCACAUUUUUGC |
hsa-miR-96brain | UUUGGCACUAGCACAUUUUUGC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.