SZGR2

Summary ?

GeneID	59341
Symbol	TRPV4
Synonyms	BCYM3\|CMT2C\|HMSN2C\|OTRPC4\|SMAL\|SPSMA\|SSQTL1\|TRP12\|VRL2\|VROAC
Description	transient receptor potential cation channel subfamily V member 4
Reference	MIM:605427\|HGNC:HGNC:18083\|Ensembl:ENSG00000111199\|HPRD:05667\|Vega:OTTHUMG00000169277
Gene type	protein-coding
Map location	12q24.1
Pascal p-value	0.002

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
Network	Shortest path distance of core genes in the Human protein-protein interaction network	Contribution to shortest path in PPI network: 0.0126

Section I. Genetics and epigenetics annotation

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005509	calcium ion binding	IEA		-
GO:0005516	calmodulin binding	IMP		12724311
GO:0005262	calcium channel activity	IDA		18458941
GO:0042802	identical protein binding	IPI		16293632
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0007204	elevation of cytosolic calcium ion concentration	IDA		18458941
GO:0007231	osmosensory signaling pathway	TAS		12724311
GO:0009612	response to mechanical stimulus	TAS		15753126
GO:0006816	calcium ion transport	IDA		18458941
GO:0006816	calcium ion transport	NAS		11025659
GO:0006811	ion transport	IEA		-
GO:0006884	cell volume homeostasis	TAS		12724311
GO:0006874	cellular calcium ion homeostasis	IDA		12724311
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0016021	integral to membrane	NAS		11025659
GO:0005886	plasma membrane	IDA		15753126

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
BARRIER CANCER RELAPSE TUMOR SAMPLE DN	13	6	All SZGR 2.0 genes in this pathway
HATADA METHYLATED IN LUNG CANCER UP	390	236	All SZGR 2.0 genes in this pathway
SCHAEFFER PROSTATE DEVELOPMENT 48HR UP	487	286	All SZGR 2.0 genes in this pathway
ROZANOV MMP14 TARGETS UP	266	171	All SZGR 2.0 genes in this pathway
DOUGLAS BMI1 TARGETS UP	566	371	All SZGR 2.0 genes in this pathway
LEIN CHOROID PLEXUS MARKERS	103	61	All SZGR 2.0 genes in this pathway
ENGELMANN CANCER PROGENITORS DN	70	44	All SZGR 2.0 genes in this pathway
RAY TUMORIGENESIS BY ERBB2 CDC25A UP	104	57	All SZGR 2.0 genes in this pathway
MEISSNER BRAIN HCP WITH H3K27ME3	269	159	All SZGR 2.0 genes in this pathway
MEISSNER NPC HCP WITH H3K4ME2	491	319	All SZGR 2.0 genes in this pathway
MARTENS TRETINOIN RESPONSE UP	857	456	All SZGR 2.0 genes in this pathway
BRUINS UVC RESPONSE VIA TP53 GROUP A	898	516	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-378	291	297	1A	hsa-miR-378	CUCCUGACUCCAGGUCCUGUGU
miR-491	166	172	m8	hsa-miR-491^brain	AGUGGGGAACCCUUCCAUGAGGA

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: TRPV4