Gene Page: UPF1
Summary ?
| GeneID | 5976 |
| Symbol | UPF1 |
| Synonyms | HUPF1|NORF1|RENT1|pNORF1|smg-2 |
| Description | UPF1, RNA helicase and ATPase |
| Reference | MIM:601430|HGNC:HGNC:9962|Ensembl:ENSG00000005007|HPRD:03254|Vega:OTTHUMG00000183025 |
| Gene type | protein-coding |
| Map location | 19p13.11 |
| Pascal p-value | 0.556 |
| Sherlock p-value | 0.147 |
| Fetal beta | 0.29 |
| Support | Ascano FMRP targets |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
| Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
| Network | Shortest path distance of core genes in the Human protein-protein interaction network | Contribution to shortest path in PPI network: 0.5939 |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0000166 | nucleotide binding | IEA | - | |
| GO:0003677 | DNA binding | IEA | - | |
| GO:0003682 | chromatin binding | IDA | 16488880 | |
| GO:0003723 | RNA binding | NAS | 10999600 | |
| GO:0004004 | ATP-dependent RNA helicase activity | IDA | 12554878 | |
| GO:0005515 | protein binding | IPI | 9620853 |11544179 | |
| GO:0005524 | ATP binding | IEA | - | |
| GO:0004386 | helicase activity | NAS | 9064659 | |
| GO:0016787 | hydrolase activity | IEA | - | |
| GO:0008270 | zinc ion binding | IEA | - | |
| GO:0046872 | metal ion binding | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0000184 | nuclear-transcribed mRNA catabolic process, nonsense-mediated decay | NAS | 10999600 | |
| GO:0006396 | RNA processing | TAS | 8855285 | |
| GO:0006406 | mRNA export from nucleus | TAS | 16488880 | |
| GO:0006449 | regulation of translational termination | IMP | 9620853 | |
| GO:0006449 | regulation of translational termination | NAS | 10999600 | |
| GO:0006281 | DNA repair | IDA | 16488880 | |
| GO:0006260 | DNA replication | IMP | 16488880 | |
| GO:0007049 | cell cycle | IMP | 16488880 | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0000785 | chromatin | IDA | 16488880 | |
| GO:0005737 | cytoplasm | NAS | 9064659 |
Section IV. Protein-protein interaction annotation
| Interactors | Aliases B | Official full name B | Experimental | Source | PubMed ID |
|---|---|---|---|---|---|
| ATM | AT1 | ATA | ATC | ATD | ATDC | ATE | DKFZp781A0353 | MGC74674 | TEL1 | TELO1 | ataxia telangiectasia mutated | ATM phosphorylates hUpf1. | BIND | 15175154 |
| DCP1A | FLJ21691 | HSA275986 | Nbla00360 | SMAD4IP1 | SMIF | DCP1 decapping enzyme homolog A (S. cerevisiae) | Affinity Capture-Western | BioGRID | 12417715 |
| DCP2 | FLJ33245 | NUDT20 | DCP2 decapping enzyme homolog (S. cerevisiae) | - | HPRD,BioGRID | 12417715 |
| EXOSC10 | PM-Scl | PM/Scl-100 | PMSCL | PMSCL2 | RRP6 | Rrp6p | p2 | p3 | p4 | exosome component 10 | Affinity Capture-Western | BioGRID | 14527413 |
| EXOSC2 | RRP4 | Rrp4p | hRrp4p | p7 | exosome component 2 | Affinity Capture-Western | BioGRID | 14527413 |
| EXOSC4 | FLJ20591 | RRP41 | RRP41A | Rrp41p | SKI6 | Ski6p | hRrp41p | p12A | exosome component 4 | - | HPRD,BioGRID | 14527413 |
| HIRA | DGCR1 | TUP1 | TUPLE1 | HIR histone cell cycle regulation defective homolog A (S. cerevisiae) | - | HPRD,BioGRID | 15231747 |
| LSM8 | YJR022W | LSM8 homolog, U6 small nuclear RNA associated (S. cerevisiae) | - | HPRD,BioGRID | 15231747 |
| PABPC1 | PAB1 | PABP | PABP1 | PABPC2 | PABPL1 | poly(A) binding protein, cytoplasmic 1 | Affinity Capture-MS | BioGRID | 12723973 |
| PARN | DAN | poly(A)-specific ribonuclease (deadenylation nuclease) | Affinity Capture-Western | BioGRID | 14527413 |
| POLR2A | MGC75453 | POLR2 | POLRA | RPB1 | RPBh1 | RPO2 | RPOL2 | RpIILS | hRPB220 | hsRPB1 | polymerase (RNA) II (DNA directed) polypeptide A, 220kDa | - | HPRD | 6200476 |
| SMG1 | 61E3.4 | ATX | KIAA0421 | LIP | PI-3-kinase-related kinase SMG-1 | - | HPRD,BioGRID | 11544179 |
| SMG1 | 61E3.4 | ATX | KIAA0421 | LIP | PI-3-kinase-related kinase SMG-1 | hSMG-1 phosphorylates hUpf1. | BIND | 15175154 |
| SMG5 | EST1B | FLJ34864 | KIAA1089 | LPTS-RP1 | LPTSRP1 | RP11-54H19.7 | SMG-5 | Smg-5 homolog, nonsense mediated mRNA decay factor (C. elegans) | - | HPRD | 14636577 |
| SMG6 | C17orf31 | EST1A | KIAA0732 | SMG-6 | Smg-6 homolog, nonsense mediated mRNA decay factor (C. elegans) | UPF1 interacts with SMG6. | BIND | 15721257 |
| SMG7 | C1orf16 | EST1C | FLJ23717 | KIAA0250 | SGA56M | SMG-7 | Smg-7 homolog, nonsense mediated mRNA decay factor (C. elegans) | SMG7 interacts with UPF1. | BIND | 15721257 |
| STAU1 | FLJ25010 | STAU | staufen, RNA binding protein, homolog 1 (Drosophila) | Upf1 interacts with Stau1. | BIND | 15680326 |
| UPF2 | DKFZp434D222 | HUPF2 | KIAA1408 | MGC138834 | MGC138835 | RENT2 | smg-3 | UPF2 regulator of nonsense transcripts homolog (yeast) | Upf1 interacts with Upf2. | BIND | 15680326 |
| UPF2 | DKFZp434D222 | HUPF2 | KIAA1408 | MGC138834 | MGC138835 | RENT2 | smg-3 | UPF2 regulator of nonsense transcripts homolog (yeast) | - | HPRD,BioGRID | 11073994 |
| UPF2 | DKFZp434D222 | HUPF2 | KIAA1408 | MGC138834 | MGC138835 | RENT2 | smg-3 | UPF2 regulator of nonsense transcripts homolog (yeast) | - | HPRD | 11073994 |12723973 |
| UPF3A | HUPF3A | RENT3A | UPF3 | UPF3 regulator of nonsense transcripts homolog A (yeast) | - | HPRD,BioGRID | 11163187 |
| UPF3B | HUPF3B | MRXS14 | RENT3B | UPF3X | UPF3 regulator of nonsense transcripts homolog B (yeast) | Upf1 interacts with Upf3X. | BIND | 15680326 |
| UPF3B | HUPF3B | MRXS14 | RENT3B | UPF3X | UPF3 regulator of nonsense transcripts homolog B (yeast) | - | HPRD,BioGRID | 12723973 |
| XRN1 | DKFZp434P0721 | DKFZp686B22225 | DKFZp686F19113 | FLJ41903 | SEP1 | 5'-3' exoribonuclease 1 | - | HPRD,BioGRID | 14527413 |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| PARENT MTOR SIGNALING UP | 567 | 375 | All SZGR 2.0 genes in this pathway |
| FRASOR TAMOXIFEN RESPONSE UP | 51 | 36 | All SZGR 2.0 genes in this pathway |
| GAZDA DIAMOND BLACKFAN ANEMIA ERYTHROID DN | 493 | 298 | All SZGR 2.0 genes in this pathway |
| CASORELLI ACUTE PROMYELOCYTIC LEUKEMIA DN | 663 | 425 | All SZGR 2.0 genes in this pathway |
| DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP | 1382 | 904 | All SZGR 2.0 genes in this pathway |
| MULLIGHAN MLL SIGNATURE 1 UP | 380 | 236 | All SZGR 2.0 genes in this pathway |
| MULLIGHAN MLL SIGNATURE 2 UP | 418 | 263 | All SZGR 2.0 genes in this pathway |
| UDAYAKUMAR MED1 TARGETS DN | 240 | 171 | All SZGR 2.0 genes in this pathway |
| LOPEZ MBD TARGETS | 957 | 597 | All SZGR 2.0 genes in this pathway |
| MATSUDA NATURAL KILLER DIFFERENTIATION | 475 | 313 | All SZGR 2.0 genes in this pathway |
| THEILGAARD NEUTROPHIL AT SKIN WOUND DN | 225 | 163 | All SZGR 2.0 genes in this pathway |
| BLALOCK ALZHEIMERS DISEASE UP | 1691 | 1088 | All SZGR 2.0 genes in this pathway |
| BROWNE HCMV INFECTION 14HR UP | 156 | 101 | All SZGR 2.0 genes in this pathway |
| BROWNE HCMV INFECTION 18HR UP | 178 | 111 | All SZGR 2.0 genes in this pathway |
| BANDRES RESPONSE TO CARMUSTIN MGMT 48HR DN | 161 | 105 | All SZGR 2.0 genes in this pathway |
| CAMPS COLON CANCER COPY NUMBER UP | 92 | 45 | All SZGR 2.0 genes in this pathway |
| BONOME OVARIAN CANCER SURVIVAL SUBOPTIMAL DEBULKING | 510 | 309 | All SZGR 2.0 genes in this pathway |
| PILON KLF1 TARGETS DN | 1972 | 1213 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-128 | 114 | 120 | m8 | hsa-miR-128a | UCACAGUGAACCGGUCUCUUUU |
| hsa-miR-128b | UCACAGUGAACCGGUCUCUUUC | ||||
| miR-186 | 567 | 573 | m8 | hsa-miR-186 | CAAAGAAUUCUCCUUUUGGGCUU |
| miR-370 | 371 | 377 | 1A | hsa-miR-370brain | GCCUGCUGGGGUGGAACCUGG |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.