Summary ?
GeneID6048
SymbolRNF5
SynonymsRING5|RMA1
Descriptionring finger protein 5, E3 ubiquitin protein ligase
ReferenceMIM:602677|HGNC:HGNC:10068|Ensembl:ENSG00000204308|HPRD:04057|Vega:OTTHUMG00000031093
Gene typeprotein-coding
Map location6p21.3
Pascal p-value1E-12
Sherlock p-value0.837
Fetal beta0.744
eGeneCerebellum
Frontal Cortex BA9

Gene in Data Sources
Gene set name Method of gene setDescriptionInfo
CV:PGCnpGenome-wide Association StudyGWAS
PMID:cooccurHigh-throughput literature-searchSystematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
GSMA_IGenome scan meta-analysisPsr: 0.033 
ExpressionMeta-analysis of gene expressionP value: 1.428 
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: schizophrenia,schizophreniasClick to show details
NetworkShortest path distance of core genes in the Human protein-protein interaction networkContribution to shortest path in PPI network: 0.025 

Section I. Genetics and epigenetics annotation


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005515protein bindingIPI12861019 |14667819 |16901789 
GO:0016874ligase activityIEA-
GO:0008270zinc ion bindingTAS9533025 
GO:0046872metal ion bindingIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006511ubiquitin-dependent protein catabolic processIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0016020membraneIEA-
GO:0016021integral to membraneIEA-

Section V. Pathway annotation

Pathway namePathway size# SZGR 2.0 genes in pathwayInfo
NAKAMURA TUMOR ZONE PERIPHERAL VS CENTRAL UP 285181All SZGR 2.0 genes in this pathway
DAVICIONI MOLECULAR ARMS VS ERMS UP 332228All SZGR 2.0 genes in this pathway
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP 1382904All SZGR 2.0 genes in this pathway
RODRIGUES DCC TARGETS DN 12184All SZGR 2.0 genes in this pathway
TIEN INTESTINE PROBIOTICS 6HR DN 167100All SZGR 2.0 genes in this pathway
JAIN NFKB SIGNALING 7544All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE DN 1237837All SZGR 2.0 genes in this pathway
YIH RESPONSE TO ARSENITE C3 3624All SZGR 2.0 genes in this pathway
STEIN ESRRA TARGETS UP 388234All SZGR 2.0 genes in this pathway
BONOME OVARIAN CANCER SURVIVAL OPTIMAL DEBULKING 246152All SZGR 2.0 genes in this pathway
MOOTHA PGC 420269All SZGR 2.0 genes in this pathway
STEIN ESRRA TARGETS 535325All SZGR 2.0 genes in this pathway
MARTENS TRETINOIN RESPONSE DN 841431All SZGR 2.0 genes in this pathway
GOBERT OLIGODENDROCYTE DIFFERENTIATION DN 1080713All SZGR 2.0 genes in this pathway
WAKABAYASHI ADIPOGENESIS PPARG RXRA BOUND 8D 882506All SZGR 2.0 genes in this pathway
DELACROIX RARG BOUND MEF 367231All SZGR 2.0 genes in this pathway
DELACROIX RAR BOUND ES 462273All SZGR 2.0 genes in this pathway
ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY 1839928All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
let-7/98426432m8hsa-let-7abrainUGAGGUAGUAGGUUGUAUAGUU
hsa-let-7bbrainUGAGGUAGUAGGUUGUGUGGUU
hsa-let-7cbrainUGAGGUAGUAGGUUGUAUGGUU
hsa-let-7dbrainAGAGGUAGUAGGUUGCAUAGU
hsa-let-7ebrainUGAGGUAGGAGGUUGUAUAGU
hsa-let-7fbrainUGAGGUAGUAGAUUGUAUAGUU
hsa-miR-98brainUGAGGUAGUAAGUUGUAUUGUU
hsa-let-7gSZUGAGGUAGUAGUUUGUACAGU
hsa-let-7ibrainUGAGGUAGUAGUUUGUGCUGU
miR-196425431m8hsa-miR-196aUAGGUAGUUUCAUGUUGUUGG
hsa-miR-196bUAGGUAGUUUCCUGUUGUUGG
miR-200bc/4294147m8hsa-miR-200bUAAUACUGCCUGGUAAUGAUGAC
hsa-miR-200cUAAUACUGCCGGGUAAUGAUGG
hsa-miR-429UAAUACUGUCUGGUAAAACCGU