Gene Page: PROK2
Summary ?
GeneID | 60675 |
Symbol | PROK2 |
Synonyms | BV8|HH4|KAL4|MIT1|PK2 |
Description | prokineticin 2 |
Reference | MIM:607002|HGNC:HGNC:18455|Ensembl:ENSG00000163421|HPRD:08446|Vega:OTTHUMG00000158809 |
Gene type | protein-coding |
Map location | 3p13 |
Pascal p-value | 0.03 |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.04047 | |
GSMA_IIE | Genome scan meta-analysis (European-ancestry samples) | Psr: 0.04359 | |
Expression | Meta-analysis of gene expression | P value: 1.597 | |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0001664 | G-protein-coupled receptor binding | TAS | 12728244 | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0007218 | neuropeptide signaling pathway | IEA | Neurotransmitter (GO term level: 8) | - |
GO:0000187 | activation of MAPK activity | TAS | 12728244 | |
GO:0001525 | angiogenesis | IDA | 12604792 | |
GO:0007204 | elevation of cytosolic calcium ion concentration | TAS | 12728244 | |
GO:0007283 | spermatogenesis | IMP | 10580115 | |
GO:0008283 | cell proliferation | IDA | 12604792 | |
GO:0006954 | inflammatory response | NAS | 11259612 | |
GO:0006935 | chemotaxis | IDA | 12604792 | |
GO:0006916 | anti-apoptosis | IDA | 12604792 | |
GO:0019233 | sensory perception of pain | TAS | 12728244 | |
GO:0045987 | positive regulation of smooth muscle contraction | IDA | 11259612 | |
GO:0048511 | rhythmic process | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005576 | extracellular region | TAS | 12466223 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
BENPORATH SUZ12 TARGETS | 1038 | 678 | All SZGR 2.0 genes in this pathway |
BENPORATH EED TARGETS | 1062 | 725 | All SZGR 2.0 genes in this pathway |
BENPORATH ES WITH H3K27ME3 | 1118 | 744 | All SZGR 2.0 genes in this pathway |
BENPORATH PRC2 TARGETS | 652 | 441 | All SZGR 2.0 genes in this pathway |
MARZEC IL2 SIGNALING DN | 36 | 24 | All SZGR 2.0 genes in this pathway |
VART KSHV INFECTION ANGIOGENIC MARKERS DN | 138 | 92 | All SZGR 2.0 genes in this pathway |
MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3 | 1069 | 729 | All SZGR 2.0 genes in this pathway |
MEISSNER NPC HCP WITH H3K4ME2 AND H3K27ME3 | 349 | 234 | All SZGR 2.0 genes in this pathway |
MIKKELSEN NPC HCP WITH H3K27ME3 | 341 | 243 | All SZGR 2.0 genes in this pathway |
KUMAR PATHOGEN LOAD BY MACROPHAGES | 275 | 155 | All SZGR 2.0 genes in this pathway |
KUMAR AUTOPHAGY NETWORK | 71 | 46 | All SZGR 2.0 genes in this pathway |
ZWANG TRANSIENTLY UP BY 2ND EGF PULSE ONLY | 1725 | 838 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-369-3p | 1048 | 1054 | 1A | hsa-miR-369-3p | AAUAAUACAUGGUUGAUCUUU |
miR-374 | 1048 | 1054 | m8 | hsa-miR-374 | UUAUAAUACAACCUGAUAAGUG |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.