Summary ?
GeneID6257
SymbolRXRB
SynonymsDAUDI6|H-2RIIBP|NR2B2|RCoR-1
Descriptionretinoid X receptor beta
ReferenceMIM:180246|HGNC:HGNC:10478|Ensembl:ENSG00000204231|HPRD:01578|Vega:OTTHUMG00000031298
Gene typeprotein-coding
Map location6p21.3
Pascal p-value2.967E-4
Sherlock p-value0.982
Fetal beta-0.466
eGeneMyers' cis & trans

Gene in Data Sources
Gene set name Method of gene setDescriptionInfo
CV:PGCnpGenome-wide Association StudyGWAS
DMG:Wockner_2014Genome-wide DNA methylation analysisThis dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). 1
PMID:cooccurHigh-throughput literature-searchSystematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
GSMA_IGenome scan meta-analysisPsr: 0.033 
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: schizophrenia,schizophreniasClick to show details

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

ProbeChromosomePositionNearest geneP (dis)Beta (dis)FDR (dis)Study
cg11724493633168040SLC39A7;RXRB1.305E-4-0.250.03DMG:Wockner_2014

@eQTL annotation

SNP IDChromosomePositioneGeneGene Entrez IDpvalueqvalueTSS distanceeQTL type
rs4854166chr23297005RXRB62570.11trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0004886retinoid-X receptor activityTAS1662118 
GO:0003700transcription factor activityIEA-
GO:0003700transcription factor activityNAS1662118 
GO:0003706ligand-regulated transcription factor activityIDA7990953 
GO:0003707steroid hormone receptor activityIEA-
GO:0003713transcription coactivator activityTAS1662118 
GO:0005496steroid bindingIEA-
GO:0008270zinc ion bindingIEA-
GO:0046872metal ion bindingIEA-
GO:0043565sequence-specific DNA bindingIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006355regulation of transcription, DNA-dependentIEA-
GO:0006350transcriptionIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005634nucleusIDA7990953 
GO:0005634nucleusIEA-

Section IV. Protein-protein interaction annotation

InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
AKAP13AKAP-Lbc | BRX | FLJ11952 | FLJ43341 | HA-3 | Ht31 | LBC | PROTO-LB | PROTO-LBC | c-lbcA kinase (PRKA) anchor protein 13-HPRD,BioGRID9627117 
NCOA1F-SRC-1 | KAT13A | MGC129719 | MGC129720 | NCoA-1 | RIP160 | SRC-1 | SRC1 | bHLHe42nuclear receptor coactivator 1-HPRD7481822 
NCOA3ACTR | AIB-1 | AIB1 | CAGH16 | CTG26 | KAT13B | MGC141848 | RAC3 | SRC3 | TNRC14 | TNRC16 | TRAM-1 | pCIPnuclear receptor coactivator 3TRAM-1 interacts with RXR-beta. This interaction was modelled on a demonstrated interaction between human TRAM-1 and mouse RXR-beta.BIND9346901 
NCOA3ACTR | AIB-1 | AIB1 | CAGH16 | CTG26 | KAT13B | MGC141848 | RAC3 | SRC3 | TNRC14 | TNRC16 | TRAM-1 | pCIPnuclear receptor coactivator 3-HPRD9267036 
NR0B2FLJ17090 | SHP | SHP1nuclear receptor subfamily 0, group B, member 2-HPRD10594021 
NR1H2LXR-b | LXRB | NER | NER-I | RIP15 | UNRnuclear receptor subfamily 1, group H, member 2-HPRD,BioGRID10187832 
NR1I2BXR | ONR1 | PAR | PAR1 | PAR2 | PARq | PRR | PXR | SAR | SXRnuclear receptor subfamily 1, group I, member 2-HPRD9727070 
NR2E3ESCS | MGC49976 | PNR | RNR | RP37 | rd7nuclear receptor subfamily 2, group E, member 3-HPRD10611353 
NR4A2HZF-3 | NOT | NURR1 | RNR1 | TINURnuclear receptor subfamily 4, group A, member 2-HPRD7705655 |7758108 
NRIP1FLJ77253 | RIP140nuclear receptor interacting protein 1-HPRD12403842 |12549917 
NRIP1FLJ77253 | RIP140nuclear receptor interacting protein 1Reconstituted ComplexBioGRID9626662 
RARANR1B1 | RARretinoic acid receptor, alphaTwo-hybridBioGRID16189514 
RARBHAP | NR1B2 | RRB2retinoic acid receptor, beta-HPRD1331778 
SPOPTEF2speckle-type POZ proteinTwo-hybridBioGRID16189514 
THRAAR7 | EAR7 | ERB-T-1 | ERBA | ERBA1 | MGC000261 | MGC43240 | NR1A1 | THRA1 | THRA2 | c-ERBA-1thyroid hormone receptor, alpha (erythroblastic leukemia viral (v-erb-a) oncogene homolog, avian)-HPRD1331778 
THRBERBA-BETA | ERBA2 | GRTH | MGC126109 | MGC126110 | NR1A2 | PRTH | THR1 | THRB1 | THRB2thyroid hormone receptor, beta (erythroblastic leukemia viral (v-erb-a) oncogene homolog 2, avian)THR-beta interacts with RXR-beta. This interaction was modelled on a demonstrated interaction between rat TR-beta and mouse RXR-beta.BIND9346901 


Section V. Pathway annotation

Pathway namePathway size# SZGR 2.0 genes in pathwayInfo
KEGG PPAR SIGNALING PATHWAY 6947All SZGR 2.0 genes in this pathway
KEGG ADIPOCYTOKINE SIGNALING PATHWAY 6757All SZGR 2.0 genes in this pathway
KEGG PATHWAYS IN CANCER 328259All SZGR 2.0 genes in this pathway
KEGG THYROID CANCER 2926All SZGR 2.0 genes in this pathway
KEGG SMALL CELL LUNG CANCER 8467All SZGR 2.0 genes in this pathway
KEGG NON SMALL CELL LUNG CANCER 5447All SZGR 2.0 genes in this pathway
PID AR TF PATHWAY 5338All SZGR 2.0 genes in this pathway
PID RXR VDR PATHWAY 2624All SZGR 2.0 genes in this pathway
PID RETINOIC ACID PATHWAY 3023All SZGR 2.0 genes in this pathway
PID A6B1 A6B4 INTEGRIN PATHWAY 4635All SZGR 2.0 genes in this pathway
REACTOME GENERIC TRANSCRIPTION PATHWAY 352181All SZGR 2.0 genes in this pathway
REACTOME NUCLEAR RECEPTOR TRANSCRIPTION PATHWAY 4936All SZGR 2.0 genes in this pathway
PARENT MTOR SIGNALING UP 567375All SZGR 2.0 genes in this pathway
BOGNI TREATMENT RELATED MYELOID LEUKEMIA DN 3319All SZGR 2.0 genes in this pathway
DODD NASOPHARYNGEAL CARCINOMA UP 1821933All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN UP 1142669All SZGR 2.0 genes in this pathway
GRAESSMANN RESPONSE TO MC AND DOXORUBICIN UP 612367All SZGR 2.0 genes in this pathway
BENPORATH MYC TARGETS WITH EBOX 230156All SZGR 2.0 genes in this pathway
BENPORATH MYC MAX TARGETS 775494All SZGR 2.0 genes in this pathway
URS ADIPOCYTE DIFFERENTIATION UP 7451All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE INCIPIENT UP 390242All SZGR 2.0 genes in this pathway
MACLACHLAN BRCA1 TARGETS DN 1612All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE UP 16911088All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 18HR UP 178111All SZGR 2.0 genes in this pathway
WEIGEL OXIDATIVE STRESS BY HNE AND TBH 6042All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 12HR UP 11168All SZGR 2.0 genes in this pathway
LEE LIVER CANCER 4929All SZGR 2.0 genes in this pathway
MATZUK SPERMATOZOA 11477All SZGR 2.0 genes in this pathway
MOOTHA PGC 420269All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS UP 1305895All SZGR 2.0 genes in this pathway
DANG BOUND BY MYC 1103714All SZGR 2.0 genes in this pathway
DUAN PRDM5 TARGETS 7952All SZGR 2.0 genes in this pathway
KOINUMA TARGETS OF SMAD2 OR SMAD3 824528All SZGR 2.0 genes in this pathway
DELACROIX RAR BOUND ES 462273All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-1016666731A,m8hsa-miR-101UACAGUACUGUGAUAACUGAAG
miR-1446676731Ahsa-miR-144UACAGUAUAGAUGAUGUACUAG