SZGR2

Summary ?

GeneID	6262
Symbol	RYR2
Synonyms	ARVC2\|ARVD2\|RYR-2\|RyR\|VTSIP
Description	ryanodine receptor 2
Reference	MIM:180902\|HGNC:HGNC:10484\|Ensembl:ENSG00000198626\|HPRD:01619\|Vega:OTTHUMG00000039543
Gene type	protein-coding
Map location	1q43
Fetal beta	-2.238
eGene	Meta
Support	INTRACELLULAR SIGNAL TRANSDUCTION G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-CONSENSUS G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-FULL G2Cdb.human_BAYES-COLLINS-MOUSE-PSD-CONSENSUS G2Cdb.humanPSD G2Cdb.humanPSP CompositeSet Darnell FMRP targets Ascano FMRP targets

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:GWASdb	Genome-wide Association Studies	GWASdb records for schizophrenia
CV:PGCnp	Genome-wide Association Study	GWAS
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias	Click to show details
Network	Shortest path distance of core genes in the Human protein-protein interaction network	Contribution to shortest path in PPI network: 0.0397

Section I. Genetics and epigenetics annotation

DNM table

Gene	Chromosome	Position	Ref	Alt	Transcript	AA change	Mutation type	Sift	CG46	Trait	Study
RYR2	chr1	237919662	G	A	NM_001035	.	silent			Schizophrenia	DNM:Fromer_2014

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
AC087071.1	0.73	0.44
AL353354.3	0.70	0.41
FAM159B	0.68	0.46
SPDYA	0.66	0.49
C17orf84	0.65	0.17
AC120053.1	0.64	0.49
AL050337.1	0.63	0.34
PIGB	0.62	0.39
NOX1	0.62	0.42
C1orf61	0.61	0.34

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
FAM82A2	-0.49	-0.32
OGDH	-0.49	-0.40
EPN2	-0.47	-0.40
CNDP2	-0.47	-0.36
MYH9	-0.47	-0.45
LARS2	-0.46	-0.30
RHOB	-0.46	-0.31
HSPA9	-0.46	-0.33
AGPAT3	-0.46	-0.40
EPM2A	-0.45	-0.33

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0004872	receptor activity	IEA		-
GO:0005509	calcium ion binding	IEA		-
GO:0005516	calmodulin binding	IEA		-
GO:0005216	ion channel activity	IEA		-
GO:0005219	ryanodine-sensitive calcium-release channel activity	IEA		-
GO:0015278	calcium-release channel activity	TAS		10830164
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0008627	induction of apoptosis by ionic changes	IDA		15044459
GO:0007165	signal transduction	NAS		10463072
GO:0008016	regulation of heart contraction	TAS		10830164
GO:0006816	calcium ion transport	IEA		-
GO:0006811	ion transport	IEA		-
GO:0006936	muscle contraction	TAS		10830164
GO:0006874	cellular calcium ion homeostasis	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0016021	integral to membrane	IEA		-
GO:0005886	plasma membrane	TAS		10830164

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
AKAP6	ADAP100 \| ADAP6 \| AKAP100 \| KIAA0311 \| MGC165020 \| PRKA6 \| mAKAP	A kinase (PRKA) anchor protein 6	-	HPRD,BioGRID	11352932
CACNA1C	CACH2 \| CACN2 \| CACNL1A1 \| CCHL1A1 \| CaV1.2 \| MGC120730 \| TS	calcium channel, voltage-dependent, L type, alpha 1C subunit	-	HPRD,BioGRID	11576544
FKBP1B	FKBP12.6 \| FKBP1L \| OTK4 \| PKBP1L \| PPIase	FK506 binding protein 1B, 12.6 kDa	-	HPRD,BioGRID	10830164 \|12443530 \|12446682
HOMER1	HOMER \| HOMER1A \| HOMER1B \| HOMER1C \| SYN47 \| Ves-1	homer homolog 1 (Drosophila)	-	HPRD,BioGRID	12887973
PPP1CA	MGC15877 \| MGC1674 \| PP-1A \| PPP1A	protein phosphatase 1, catalytic subunit, alpha isoform	Co-fractionation	BioGRID	10830164
PPP1CB	MGC3672 \| PP-1B \| PPP1CD	protein phosphatase 1, catalytic subunit, beta isoform	Co-fractionation	BioGRID	10830164
PPP1CC	PPP1G	protein phosphatase 1, catalytic subunit, gamma isoform	Co-fractionation	BioGRID	10830164
PRKACA	MGC102831 \| MGC48865 \| PKACA	protein kinase, cAMP-dependent, catalytic, alpha	Biochemical Activity Co-fractionation	BioGRID	10830164
PRKACB	DKFZp781I2452 \| MGC41879 \| MGC9320 \| PKACB	protein kinase, cAMP-dependent, catalytic, beta	Biochemical Activity Co-fractionation	BioGRID	10830164
PRKACG	KAPG \| PKACg	protein kinase, cAMP-dependent, catalytic, gamma	Biochemical Activity Co-fractionation	BioGRID	10830164
PRKAR2A	MGC3606 \| PKR2 \| PRKAR2	protein kinase, cAMP-dependent, regulatory, type II, alpha	-	HPRD,BioGRID	10830164
PRKAR2B	PRKAR2 \| RII-BETA	protein kinase, cAMP-dependent, regulatory, type II, beta	Co-fractionation	BioGRID	10830164
RYR1	CCO \| MHS \| MHS1 \| RYDR \| RYR \| SKRR	ryanodine receptor 1 (skeletal)	-	HPRD,BioGRID	12213830
RYR2	ARVC2 \| ARVD2 \| VTSIP	ryanodine receptor 2 (cardiac)	Co-fractionation	BioGRID	10830164
RYR3	-	ryanodine receptor 3	-	HPRD,BioGRID	12213830
SRI	FLJ26259 \| SCN	sorcin	-	HPRD,BioGRID	7592856

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG CALCIUM SIGNALING PATHWAY	178	134	All SZGR 2.0 genes in this pathway
KEGG CARDIAC MUSCLE CONTRACTION	80	51	All SZGR 2.0 genes in this pathway
KEGG HYPERTROPHIC CARDIOMYOPATHY HCM	85	65	All SZGR 2.0 genes in this pathway
KEGG ARRHYTHMOGENIC RIGHT VENTRICULAR CARDIOMYOPATHY ARVC	76	59	All SZGR 2.0 genes in this pathway
KEGG DILATED CARDIOMYOPATHY	92	68	All SZGR 2.0 genes in this pathway
BIOCARTA NO1 PATHWAY	33	24	All SZGR 2.0 genes in this pathway
PIEPOLI LGI1 TARGETS UP	15	11	All SZGR 2.0 genes in this pathway
DELYS THYROID CANCER DN	232	154	All SZGR 2.0 genes in this pathway
MODY HIPPOCAMPUS POSTNATAL	63	50	All SZGR 2.0 genes in this pathway
LEIN NEURON MARKERS	69	45	All SZGR 2.0 genes in this pathway
YAUCH HEDGEHOG SIGNALING PARACRINE DN	264	159	All SZGR 2.0 genes in this pathway
VANASSE BCL2 TARGETS UP	40	25	All SZGR 2.0 genes in this pathway
MEISSNER NPC HCP WITH H3K4ME2 AND H3K27ME3	349	234	All SZGR 2.0 genes in this pathway
WONG ADULT TISSUE STEM MODULE	721	492	All SZGR 2.0 genes in this pathway
MIKKELSEN NPC HCP WITH H3K27ME3	341	243	All SZGR 2.0 genes in this pathway
MIKKELSEN MEF HCP WITH H3K27ME3	590	403	All SZGR 2.0 genes in this pathway
KIM ALL DISORDERS CALB1 CORR UP	548	370	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-124.1	463	469	m8	hsa-miR-124a	UUAAGGCACGCGGUGAAUGCCA
miR-124/506	462	469	1A,m8	hsa-miR-506	UAAGGCACCCUUCUGAGUAGA
miR-124/506	462	469	1A,m8	hsa-miR-124^brain	UAAGGCACGCGGUGAAUGCC
miR-129-5p	810	817	1A,m8	hsa-miR-129^brain	CUUUUUGCGGUCUGGGCUUGC
miR-129-5p	810	817	1A,m8	hsa-miR-129-5p	CUUUUUGCGGUCUGGGCUUGCU
miR-137	1107	1114	1A,m8	hsa-miR-137	UAUUGCUUAAGAAUACGCGUAG
miR-153	486	492	m8	hsa-miR-153	UUGCAUAGUCACAAAAGUGA
miR-153	486	492	m8	hsa-miR-153	UUGCAUAGUCACAAAAGUGA
miR-204/211	452	458	1A	hsa-miR-204^brain	UUCCCUUUGUCAUCCUAUGCCU
miR-204/211	452	458	1A	hsa-miR-211	UUCCCUUUGUCAUCCUUCGCCU
miR-221/222	415	421	1A	hsa-miR-221^brain	AGCUACAUUGUCUGCUGGGUUUC
miR-221/222	415	421	1A	hsa-miR-222^brain	AGCUACAUCUGGCUACUGGGUCUC
miR-375	869	875	1A	hsa-miR-375	UUUGUUCGUUCGGCUCGCGUGA
miR-448	854	860	1A	hsa-miR-448	UUGCAUAUGUAGGAUGUCCCAU
miR-450	810	816	1A	hsa-miR-450	UUUUUGCGAUGUGUUCCUAAUA
miR-485-3p	790	797	1A,m8	hsa-miR-485-3p	GUCAUACACGGCUCUCCUCUCU
miR-544	489	495	m8	hsa-miR-544	AUUCUGCAUUUUUAGCAAGU

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: RYR2