Summary ?
GeneID6272
SymbolSORT1
SynonymsGp95|LDLCQ6|NT3|NTR3
Descriptionsortilin 1
ReferenceMIM:602458|HGNC:HGNC:11186|Ensembl:ENSG00000134243|HPRD:03910|Vega:OTTHUMG00000011999
Gene typeprotein-coding
Map location1p13.3|1p21.3-p13.1
Pascal p-value0.638
Fetal beta-1.17
DMG1 (# studies)
SupportCompositeSet
Darnell FMRP targets

Gene in Data Sources
Gene set name Method of gene setDescriptionInfo
DMG:Jaffe_2016Genome-wide DNA methylation analysisThis dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. 2
PMID:cooccurHigh-throughput literature-searchSystematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: schizophrenia,schizophreniasClick to show details
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 2 

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

ProbeChromosomePositionNearest geneP (dis)Beta (dis)FDR (dis)Study
cg006839611109940786SORT11.59E-8-0.0215.92E-6DMG:Jaffe_2016
cg097646971109940754SORT14.65E-8-0.0071.26E-5DMG:Jaffe_2016


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0010465nerve growth factor receptor activityIDAneuron (GO term level: 7)14985763 
GO:0004872receptor activityIEA-
GO:0005344oxygen transporter activityIEA-
GO:0048406nerve growth factor bindingIPI14985763 
GO:0019899enzyme bindingIPI10085125 
GO:0030379neurotensin receptor activity, non-G-protein coupledIDA9756851 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0007218neuropeptide signaling pathwayIDANeurotransmitter (GO term level: 8)9756851 
GO:0001503ossificationIEA-
GO:0016050vesicle organizationIDA15992544 
GO:0008333endosome to lysosome transportIDA11331584 
GO:0048011nerve growth factor receptor signaling pathwayIMP14985763 
GO:0006810transportIEA-
GO:0008624induction of apoptosis by extracellular signalsIMP14985763 
GO:0006897endocytosisIEA-
GO:0006895Golgi to endosome transportIDA11331584 
GO:0007275multicellular organismal developmentIEA-
GO:0010468regulation of gene expressionIMP18258592 
GO:0043066negative regulation of apoptosisIDA14985763 
GO:0030154cell differentiationIEA-
GO:0051005negative regulation of lipoprotein lipase activityIDA10085125 
GO:0014902myotube differentiationIMP18258592 
GO:0032868response to insulin stimulusIMP15992544 
GO:0048227plasma membrane to endosome transportIDA11331584 
GO:0032509endosome transport via multivesicular body sorting pathwayIDA11331584 
GO:0046323glucose importIMP15992544 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005792microsomeIDA15992544 
GO:0005794Golgi apparatusIEA-
GO:0005789endoplasmic reticulum membraneIEA-
GO:0005634nucleusIEA-
GO:0005765lysosomal membraneIEA-
GO:0005769early endosomeIDA11331584 
GO:0005783endoplasmic reticulumIEA-
GO:0016021integral to membraneIEA-
GO:0016023cytoplasmic membrane-bounded vesicleIDA9756851 
GO:0009986cell surfaceIDA10085125 
GO:0005905coated pitIDA11331584 
GO:0005886plasma membraneIEA-
GO:0048471perinuclear region of cytoplasmIDA11331584 
GO:0010008endosome membraneIEA-
GO:0030140trans-Golgi network transport vesicleIEA-
GO:0031965nuclear membraneIEA-

Section V. Pathway annotation

Pathway namePathway size# SZGR 2.0 genes in pathwayInfo
KEGG LYSOSOME 12183All SZGR 2.0 genes in this pathway
KEGG NEUROTROPHIN SIGNALING PATHWAY 126103All SZGR 2.0 genes in this pathway
PID P75 NTR PATHWAY 6951All SZGR 2.0 genes in this pathway
REACTOME MEMBRANE TRAFFICKING 12974All SZGR 2.0 genes in this pathway
REACTOME TRANS GOLGI NETWORK VESICLE BUDDING 6031All SZGR 2.0 genes in this pathway
REACTOME GOLGI ASSOCIATED VESICLE BIOGENESIS 5327All SZGR 2.0 genes in this pathway
BERTUCCI MEDULLARY VS DUCTAL BREAST CANCER DN 169118All SZGR 2.0 genes in this pathway
SCHUETZ BREAST CANCER DUCTAL INVASIVE DN 8453All SZGR 2.0 genes in this pathway
FULCHER INFLAMMATORY RESPONSE LECTIN VS LPS DN 463290All SZGR 2.0 genes in this pathway
DEURIG T CELL PROLYMPHOCYTIC LEUKEMIA UP 368234All SZGR 2.0 genes in this pathway
TONKS TARGETS OF RUNX1 RUNX1T1 FUSION HSC UP 185126All SZGR 2.0 genes in this pathway
ELVIDGE HYPOXIA DN 14694All SZGR 2.0 genes in this pathway
DODD NASOPHARYNGEAL CARCINOMA UP 1821933All SZGR 2.0 genes in this pathway
MATTIOLI MULTIPLE MYELOMA WITH 14Q32 TRANSLOCATIONS 3625All SZGR 2.0 genes in this pathway
PUJANA BRCA1 PCC NETWORK 16521023All SZGR 2.0 genes in this pathway
PUJANA CHEK2 PCC NETWORK 779480All SZGR 2.0 genes in this pathway
LIAO METASTASIS 539324All SZGR 2.0 genes in this pathway
BENPORATH SOX2 TARGETS 734436All SZGR 2.0 genes in this pathway
STARK HYPPOCAMPUS 22Q11 DELETION UP 5340All SZGR 2.0 genes in this pathway
WANG IMMORTALIZED BY HOXA9 AND MEIS1 UP 3124All SZGR 2.0 genes in this pathway
ZHAN MULTIPLE MYELOMA CD2 UP 4532All SZGR 2.0 genes in this pathway
VERHAAK AML WITH NPM1 MUTATED UP 183111All SZGR 2.0 genes in this pathway
ZHAN MULTIPLE MYELOMA CD1 VS CD2 DN 5235All SZGR 2.0 genes in this pathway
HELLER HDAC TARGETS SILENCED BY METHYLATION UP 461298All SZGR 2.0 genes in this pathway
MARTINEZ RB1 TARGETS DN 543317All SZGR 2.0 genes in this pathway
MARTINEZ TP53 TARGETS UP 602364All SZGR 2.0 genes in this pathway
MARTINEZ RB1 AND TP53 TARGETS UP 601369All SZGR 2.0 genes in this pathway
ACEVEDO NORMAL TISSUE ADJACENT TO LIVER TUMOR UP 17496All SZGR 2.0 genes in this pathway
ACEVEDO LIVER CANCER UP 973570All SZGR 2.0 genes in this pathway
BOCHKIS FOXA2 TARGETS 425261All SZGR 2.0 genes in this pathway
ZHANG TLX TARGETS 36HR UP 221150All SZGR 2.0 genes in this pathway
CHEN METABOLIC SYNDROM NETWORK 1210725All SZGR 2.0 genes in this pathway
SHAFFER IRF4 TARGETS IN MYELOMA VS MATURE B LYMPHOCYTE 10176All SZGR 2.0 genes in this pathway
SHAFFER IRF4 TARGETS IN PLASMA CELL VS MATURE B LYMPHOCYTE 6751All SZGR 2.0 genes in this pathway
KATSANOU ELAVL1 TARGETS UP 169105All SZGR 2.0 genes in this pathway
WAKABAYASHI ADIPOGENESIS PPARG RXRA BOUND 8D 882506All SZGR 2.0 genes in this pathway
WAKABAYASHI ADIPOGENESIS PPARG RXRA BOUND WITH H4K20ME1 MARK 14582All SZGR 2.0 genes in this pathway
VERNOCHET ADIPOGENESIS 1911All SZGR 2.0 genes in this pathway
LIM MAMMARY LUMINAL MATURE UP 11665All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-125/35140804086m8hsa-miR-125bbrainUCCCUGAGACCCUAACUUGUGA
hsa-miR-125abrainUCCCUGAGACCCUUUAACCUGUG
miR-142-5p385338591Ahsa-miR-142-5pCAUAAAGUAGAAAGCACUAC
miR-146394439511A,m8hsa-miR-146aUGAGAACUGAAUUCCAUGGGUU
hsa-miR-146bbrainUGAGAACUGAAUUCCAUAGGCU
miR-182153815441Ahsa-miR-182UUUGGCAAUGGUAGAACUCACA
miR-24*6246301Ahsa-miR-189GUGCCUACUGAGCUGAUAUCAGU
miR-410385538611Ahsa-miR-410AAUAUAACACAGAUGGCCUGU
miR-50440824088m8hsa-miR-504AGACCCUGGUCUGCACUCUAU
miR-935343540m8hsa-miR-9SZUCUUUGGUUAUCUAGCUGUAUGA
miR-96153715441A,m8hsa-miR-96brainUUUGGCACUAGCACAUUUUUGC