Gene Page: SALL1
Summary ?
| GeneID | 6299 |
| Symbol | SALL1 |
| Synonyms | HEL-S-89|HSAL1|Sal-1|TBS|ZNF794 |
| Description | spalt-like transcription factor 1 |
| Reference | MIM:602218|HGNC:HGNC:10524|Ensembl:ENSG00000103449|HPRD:03742|Vega:OTTHUMG00000133176 |
| Gene type | protein-coding |
| Map location | 16q12.1 |
| Pascal p-value | 0.374 |
| Fetal beta | 0.432 |
| DMG | 1 (# studies) |
| eGene | Myers' cis & trans |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 2 |
| GSMA_IIE | Genome scan meta-analysis (European-ancestry samples) | Psr: 0.01775 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
| Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
|---|---|---|---|---|---|---|---|
| cg04550052 | 16 | 51184355 | SALL1 | 3.87E-6 | -0.342 | 0.009 | DMG:Wockner_2014 |
| cg02018076 | 16 | 51175381 | SALL1 | 3.6E-5 | -0.388 | 0.02 | DMG:Wockner_2014 |
eQTL annotation
| SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
|---|---|---|---|---|---|---|---|---|
| rs1507047 | chr16 | 50932778 | SALL1 | 6299 | 0.1 | cis |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| KCNB1 | 0.97 | 0.95 |
| AAK1 | 0.95 | 0.95 |
| KCNMA1 | 0.95 | 0.84 |
| GABRB2 | 0.94 | 0.89 |
| ARHGAP26 | 0.94 | 0.85 |
| ADAM22 | 0.94 | 0.92 |
| BSN | 0.94 | 0.93 |
| ATP2B2 | 0.93 | 0.92 |
| PLCB1 | 0.93 | 0.89 |
| CNNM1 | 0.93 | 0.91 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| BCL7C | -0.45 | -0.49 |
| AC006276.2 | -0.44 | -0.42 |
| EFEMP2 | -0.43 | -0.45 |
| RPL35 | -0.43 | -0.48 |
| DBI | -0.42 | -0.58 |
| RAB13 | -0.42 | -0.54 |
| RPL31 | -0.41 | -0.43 |
| RAB34 | -0.41 | -0.51 |
| C9orf46 | -0.41 | -0.37 |
| RPLP1 | -0.41 | -0.42 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0003700 | transcription factor activity | TAS | 9425907 | |
| GO:0008270 | zinc ion binding | IEA | - | |
| GO:0046872 | metal ion binding | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0001657 | ureteric bud development | IEA | - | |
| GO:0006355 | regulation of transcription, DNA-dependent | IEA | - | |
| GO:0006350 | transcription | IEA | - | |
| GO:0009653 | anatomical structure morphogenesis | TAS | 9425907 | |
| GO:0031129 | inductive cell-cell signaling | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005622 | intracellular | IEA | - | |
| GO:0005634 | nucleus | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| BASAKI YBX1 TARGETS DN | 384 | 230 | All SZGR 2.0 genes in this pathway |
| TANAKA METHYLATED IN ESOPHAGEAL CARCINOMA | 103 | 58 | All SZGR 2.0 genes in this pathway |
| KORKOLA YOLK SAC TUMOR | 62 | 33 | All SZGR 2.0 genes in this pathway |
| BENPORATH ES 1 | 379 | 235 | All SZGR 2.0 genes in this pathway |
| BENPORATH NANOG TARGETS | 988 | 594 | All SZGR 2.0 genes in this pathway |
| BENPORATH OCT4 TARGETS | 290 | 172 | All SZGR 2.0 genes in this pathway |
| BENPORATH SOX2 TARGETS | 734 | 436 | All SZGR 2.0 genes in this pathway |
| BENPORATH NOS TARGETS | 179 | 105 | All SZGR 2.0 genes in this pathway |
| FLECHNER BIOPSY KIDNEY TRANSPLANT REJECTED VS OK DN | 546 | 351 | All SZGR 2.0 genes in this pathway |
| SATO SILENCED EPIGENETICALLY IN PANCREATIC CANCER | 49 | 30 | All SZGR 2.0 genes in this pathway |
| BROWNE HCMV INFECTION 12HR UP | 111 | 68 | All SZGR 2.0 genes in this pathway |
| SATO SILENCED BY METHYLATION IN PANCREATIC CANCER 1 | 419 | 273 | All SZGR 2.0 genes in this pathway |
| YAGUE PRETUMOR DRUG RESISTANCE UP | 8 | 5 | All SZGR 2.0 genes in this pathway |
| LEE LIVER CANCER SURVIVAL UP | 185 | 112 | All SZGR 2.0 genes in this pathway |
| MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3 | 1069 | 729 | All SZGR 2.0 genes in this pathway |
| CHIANG LIVER CANCER SUBCLASS CTNNB1 UP | 176 | 110 | All SZGR 2.0 genes in this pathway |
| KARLSSON TGFB1 TARGETS UP | 127 | 78 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-101 | 1074 | 1080 | 1A | hsa-miR-101 | UACAGUACUGUGAUAACUGAAG |
| miR-103/107 | 800 | 806 | m8 | hsa-miR-103brain | AGCAGCAUUGUACAGGGCUAUGA |
| hsa-miR-107brain | AGCAGCAUUGUACAGGGCUAUCA | ||||
| miR-132/212 | 989 | 996 | 1A,m8 | hsa-miR-212SZ | UAACAGUCUCCAGUCACGGCC |
| hsa-miR-132brain | UAACAGUCUACAGCCAUGGUCG | ||||
| miR-144 | 1073 | 1080 | 1A,m8 | hsa-miR-144 | UACAGUAUAGAUGAUGUACUAG |
| miR-15/16/195/424/497 | 801 | 808 | 1A,m8 | hsa-miR-15abrain | UAGCAGCACAUAAUGGUUUGUG |
| hsa-miR-16brain | UAGCAGCACGUAAAUAUUGGCG | ||||
| hsa-miR-15bbrain | UAGCAGCACAUCAUGGUUUACA | ||||
| hsa-miR-195SZ | UAGCAGCACAGAAAUAUUGGC | ||||
| hsa-miR-424 | CAGCAGCAAUUCAUGUUUUGAA | ||||
| hsa-miR-497 | CAGCAGCACACUGUGGUUUGU | ||||
| miR-155 | 335 | 341 | 1A | hsa-miR-155 | UUAAUGCUAAUCGUGAUAGGGG |
| miR-17-5p/20/93.mr/106/519.d | 1000 | 1006 | m8 | hsa-miR-17-5p | CAAAGUGCUUACAGUGCAGGUAGU |
| hsa-miR-20abrain | UAAAGUGCUUAUAGUGCAGGUAG | ||||
| hsa-miR-106a | AAAAGUGCUUACAGUGCAGGUAGC | ||||
| hsa-miR-106bSZ | UAAAGUGCUGACAGUGCAGAU | ||||
| hsa-miR-20bSZ | CAAAGUGCUCAUAGUGCAGGUAG | ||||
| hsa-miR-519d | CAAAGUGCCUCCCUUUAGAGUGU | ||||
| miR-186 | 691 | 698 | 1A,m8 | hsa-miR-186 | CAAAGAAUUCUCCUUUUGGGCUU |
| hsa-miR-186 | CAAAGAAUUCUCCUUUUGGGCUU | ||||
| hsa-miR-186 | CAAAGAAUUCUCCUUUUGGGCUU | ||||
| miR-194 | 991 | 998 | 1A,m8 | hsa-miR-194 | UGUAACAGCAACUCCAUGUGGA |
| miR-214 | 444 | 450 | m8 | hsa-miR-214brain | ACAGCAGGCACAGACAGGCAG |
| miR-26 | 637 | 643 | m8 | hsa-miR-26abrain | UUCAAGUAAUCCAGGAUAGGC |
| hsa-miR-26bSZ | UUCAAGUAAUUCAGGAUAGGUU | ||||
| miR-338 | 446 | 452 | 1A | hsa-miR-338brain | UCCAGCAUCAGUGAUUUUGUUGA |
| miR-365 | 334 | 340 | 1A | hsa-miR-365 | UAAUGCCCCUAAAAAUCCUUAU |
| miR-376 | 111 | 118 | 1A,m8 | hsa-miR-376a | AUCAUAGAGGAAAAUCCACGU |
| hsa-miR-376b | AUCAUAGAGGAAAAUCCAUGUU | ||||
| miR-452 | 205 | 212 | 1A,m8 | hsa-miR-452 | UGUUUGCAGAGGAAACUGAGAC |
| miR-493-5p | 890 | 896 | m8 | hsa-miR-493-5p | UUGUACAUGGUAGGCUUUCAUU |
| hsa-miR-493-5p | UUGUACAUGGUAGGCUUUCAUU | ||||
| miR-503 | 802 | 808 | 1A | hsa-miR-503 | UAGCAGCGGGAACAGUUCUGCAG |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.