Summary ?
GeneID6310
SymbolATXN1
SynonymsATX1|D6S504E|SCA1
Descriptionataxin 1
ReferenceMIM:601556|HGNC:HGNC:10548|Ensembl:ENSG00000124788|HPRD:03333|Vega:OTTHUMG00000014303
Gene typeprotein-coding
Map location6p23
Pascal p-value0.003
Sherlock p-value0.644
Fetal beta-0.568
eGeneMeta
SupportCompositeSet
Darnell FMRP targets

Gene in Data Sources
Gene set name Method of gene setDescriptionInfo
CV:GWASdbGenome-wide Association StudiesGWASdb records for schizophrenia
CV:PGCnpGenome-wide Association StudyGWAS
AssociationA combined odds ratio method (Sun et al. 2008), association studies2Link to SZGene
NetworkShortest path distance of core genes in the Human protein-protein interaction networkContribution to shortest path in PPI network: 15.9635 

Section I. Genetics and epigenetics annotation


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
GenePearson's Correlation Spearman's Correlation
MYLK0.760.82
ACSL60.740.79
CBX70.740.80
SUSD50.740.77
KY0.730.72
FBLN70.730.66
KCNS30.730.78
EHD20.730.82
KLF90.720.79
BHLHE400.720.74
Top 10 negatively co-expressed genes
GenePearson's Correlation Spearman's Correlation
KIAA1949-0.55-0.56
TUBB2B-0.55-0.62
TRAF4-0.54-0.69
BCL7C-0.54-0.72
ZNF311-0.53-0.59
MARCKSL1-0.52-0.56
HN1-0.52-0.55
DYNLT1-0.52-0.75
PAFAH1B3-0.52-0.63
PPP1R14B-0.52-0.70

Section III. Gene Ontology annotation

Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0003723RNA bindingIEA-
GO:0008266poly(U) bindingIDA11136710 
GO:0008022protein C-terminus bindingIPI12757932 |15016912 
GO:0016564transcription repressor activityIDA15016912 
GO:0034046poly(rG) bindingIDA11136710 
GO:0042802identical protein bindingIPI16713569 
GO:0043621protein self-associationIDA9097953 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006396RNA processingNAS15615787 
GO:0008219cell deathIEA-
GO:0016481negative regulation of transcriptionIDA15016912 
GO:0051168nuclear exportIDA15615787 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005634nucleusIDA7647801 
GO:0005654nucleoplasmIDA12757932 
GO:0005737cytoplasmIDA7647801 
GO:0042272nuclear RNA export factor complexIDA15615787 
GO:0016363nuclear matrixIDA17557114 
GO:0042405nuclear inclusion bodyIDA15615787 

Section V. Pathway annotation

Pathway namePathway size# SZGR 2.0 genes in pathwayInfo
PARENT MTOR SIGNALING UP 567375All SZGR 2.0 genes in this pathway
ZHOU INFLAMMATORY RESPONSE LIVE UP 485293All SZGR 2.0 genes in this pathway
CORRE MULTIPLE MYELOMA UP 7445All SZGR 2.0 genes in this pathway
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP 1382904All SZGR 2.0 genes in this pathway
DEURIG T CELL PROLYMPHOCYTIC LEUKEMIA DN 320184All SZGR 2.0 genes in this pathway
DOANE RESPONSE TO ANDROGEN DN 241146All SZGR 2.0 genes in this pathway
OSMAN BLADDER CANCER UP 404246All SZGR 2.0 genes in this pathway
MULLIGHAN MLL SIGNATURE 2 UP 418263All SZGR 2.0 genes in this pathway
TONKS TARGETS OF RUNX1 RUNX1T1 FUSION ERYTHROCYTE UP 157104All SZGR 2.0 genes in this pathway
ELVIDGE HYPOXIA UP 171112All SZGR 2.0 genes in this pathway
ELVIDGE HYPOXIA BY DMOG UP 13085All SZGR 2.0 genes in this pathway
ELVIDGE HIF1A TARGETS DN 9158All SZGR 2.0 genes in this pathway
ELVIDGE HIF1A AND HIF2A TARGETS DN 10472All SZGR 2.0 genes in this pathway
RODRIGUES THYROID CARCINOMA POORLY DIFFERENTIATED DN 805505All SZGR 2.0 genes in this pathway
RODRIGUES THYROID CARCINOMA DN 7752All SZGR 2.0 genes in this pathway
LINDGREN BLADDER CANCER CLUSTER 3 DN 229142All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 TTD DN 8463All SZGR 2.0 genes in this pathway
ROVERSI GLIOMA LOH REGIONS 4430All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 DN 855609All SZGR 2.0 genes in this pathway
SEMBA FHIT TARGETS UP 117All SZGR 2.0 genes in this pathway
SPIELMAN LYMPHOBLAST EUROPEAN VS ASIAN DN 584395All SZGR 2.0 genes in this pathway
OZEN MIR125B1 TARGETS 2515All SZGR 2.0 genes in this pathway
SHEN SMARCA2 TARGETS UP 424268All SZGR 2.0 genes in this pathway
LU IL4 SIGNALING 9456All SZGR 2.0 genes in this pathway
MANALO HYPOXIA UP 207145All SZGR 2.0 genes in this pathway
YAGI AML FAB MARKERS 191131All SZGR 2.0 genes in this pathway
IVANOVA HEMATOPOIESIS STEM CELL LONG TERM 302191All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE DN 1237837All SZGR 2.0 genes in this pathway
DEBIASI APOPTOSIS BY REOVIRUS INFECTION DN 287208All SZGR 2.0 genes in this pathway
BAELDE DIABETIC NEPHROPATHY DN 434302All SZGR 2.0 genes in this pathway
WANG SMARCE1 TARGETS UP 280183All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 12HR DN 10164All SZGR 2.0 genes in this pathway
KRIGE RESPONSE TO TOSEDOSTAT 6HR UP 953554All SZGR 2.0 genes in this pathway
KRIGE RESPONSE TO TOSEDOSTAT 24HR UP 783442All SZGR 2.0 genes in this pathway
CREIGHTON ENDOCRINE THERAPY RESISTANCE 1 528324All SZGR 2.0 genes in this pathway
MARSON BOUND BY FOXP3 STIMULATED 1022619All SZGR 2.0 genes in this pathway
MARSON BOUND BY FOXP3 UNSTIMULATED 1229713All SZGR 2.0 genes in this pathway
RIGGINS TAMOXIFEN RESISTANCE DN 220147All SZGR 2.0 genes in this pathway
ACEVEDO LIVER CANCER UP 973570All SZGR 2.0 genes in this pathway
MITSIADES RESPONSE TO APLIDIN DN 249165All SZGR 2.0 genes in this pathway
ZHANG BREAST CANCER PROGENITORS UP 425253All SZGR 2.0 genes in this pathway
BOYLAN MULTIPLE MYELOMA C DN 5939All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS UP 1305895All SZGR 2.0 genes in this pathway
ROME INSULIN TARGETS IN MUSCLE UP 442263All SZGR 2.0 genes in this pathway
YAGI AML WITH T 8 21 TRANSLOCATION 368247All SZGR 2.0 genes in this pathway
YAGI AML WITH T 9 11 TRANSLOCATION 13087All SZGR 2.0 genes in this pathway
YAGI AML WITH 11Q23 REARRANGED 351238All SZGR 2.0 genes in this pathway
BOYLAN MULTIPLE MYELOMA PCA3 UP 8054All SZGR 2.0 genes in this pathway
GUTIERREZ CHRONIC LYMPHOCYTIC LEUKEMIA DN 5639All SZGR 2.0 genes in this pathway
WANG RESPONSE TO GSK3 INHIBITOR SB216763 UP 397206All SZGR 2.0 genes in this pathway
HOELZEL NF1 TARGETS UP 13993All SZGR 2.0 genes in this pathway
BHAT ESR1 TARGETS NOT VIA AKT1 DN 8861All SZGR 2.0 genes in this pathway
TORCHIA TARGETS OF EWSR1 FLI1 FUSION DN 321200All SZGR 2.0 genes in this pathway
KOINUMA TARGETS OF SMAD2 OR SMAD3 824528All SZGR 2.0 genes in this pathway
PURBEY TARGETS OF CTBP1 NOT SATB1 DN 448282All SZGR 2.0 genes in this pathway
ACEVEDO FGFR1 TARGETS IN PROSTATE CANCER MODEL DN 308187All SZGR 2.0 genes in this pathway
ZWANG CLASS 3 TRANSIENTLY INDUCED BY EGF 222159All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
let-7/98382138271Ahsa-let-7abrainUGAGGUAGUAGGUUGUAUAGUU
hsa-let-7bbrainUGAGGUAGUAGGUUGUGUGGUU
hsa-let-7cbrainUGAGGUAGUAGGUUGUAUGGUU
hsa-let-7dbrainAGAGGUAGUAGGUUGCAUAGU
hsa-let-7ebrainUGAGGUAGGAGGUUGUAUAGU
hsa-let-7fbrainUGAGGUAGUAGAUUGUAUAGUU
hsa-miR-98brainUGAGGUAGUAAGUUGUAUUGUU
hsa-let-7gSZUGAGGUAGUAGUUUGUACAGU
hsa-let-7ibrainUGAGGUAGUAGUUUGUGCUGU
miR-101117411811A,m8hsa-miR-101UACAGUACUGUGAUAACUGAAG
hsa-miR-101UACAGUACUGUGAUAACUGAAG
hsa-miR-101UACAGUACUGUGAUAACUGAAG
hsa-miR-101UACAGUACUGUGAUAACUGAAG
miR-125/351409741041A,m8hsa-miR-125bbrainUCCCUGAGACCCUAACUUGUGA
hsa-miR-125abrainUCCCUGAGACCCUUUAACCUGUG
hsa-miR-125bbrainUCCCUGAGACCCUAACUUGUGA
hsa-miR-125abrainUCCCUGAGACCCUUUAACCUGUG
miR-130/301692969361A,m8hsa-miR-130abrainCAGUGCAAUGUUAAAAGGGCAU
hsa-miR-301CAGUGCAAUAGUAUUGUCAAAGC
hsa-miR-130bbrainCAGUGCAAUGAUGAAAGGGCAU
hsa-miR-454-3pUAGUGCAAUAUUGCUUAUAGGGUUU
miR-132/21237233729m8hsa-miR-212SZUAACAGUCUCCAGUCACGGCC
hsa-miR-132brainUAACAGUCUACAGCCAUGGUCG
miR-137266226681Ahsa-miR-137UAUUGCUUAAGAAUACGCGUAG
miR-1396066m8hsa-miR-139brainUCUACAGUGCACGUGUCU
miR-141/200a8698761A,m8hsa-miR-141UAACACUGUCUGGUAAAGAUGG
hsa-miR-200aUAACACUGUCUGGUAACGAUGU
hsa-miR-141UAACACUGUCUGGUAAAGAUGG
hsa-miR-200aUAACACUGUCUGGUAACGAUGU
hsa-miR-141UAACACUGUCUGGUAAAGAUGG
hsa-miR-200aUAACACUGUCUGGUAACGAUGU
miR-14454385444m8hsa-miR-144UACAGUAUAGAUGAUGUACUAG
hsa-miR-144UACAGUAUAGAUGAUGUACUAG
hsa-miR-144UACAGUAUAGAUGAUGUACUAG
hsa-miR-144UACAGUAUAGAUGAUGUACUAG
hsa-miR-144UACAGUAUAGAUGAUGUACUAG
miR-148/1526776841A,m8hsa-miR-148aUCAGUGCACUACAGAACUUUGU
hsa-miR-152brainUCAGUGCAUGACAGAACUUGGG
hsa-miR-148bUCAGUGCAUCACAGAACUUUGU
miR-17-5p/20/93.mr/106/519.d41474153m8hsa-miR-17-5pCAAAGUGCUUACAGUGCAGGUAGU
hsa-miR-20abrainUAAAGUGCUUAUAGUGCAGGUAG
hsa-miR-106aAAAAGUGCUUACAGUGCAGGUAGC
hsa-miR-106bSZUAAAGUGCUGACAGUGCAGAU
hsa-miR-20bSZCAAAGUGCUCAUAGUGCAGGUAG
hsa-miR-519dCAAAGUGCCUCCCUUUAGAGUGU
miR-18680868151A,m8hsa-miR-18aUAAGGUGCAUCUAGUGCAGAUA
hsa-miR-18bUAAGGUGCAUCUAGUGCAGUUA
miR-18151575163m8hsa-miR-181abrainAACAUUCAACGCUGUCGGUGAGU
hsa-miR-181bSZAACAUUCAUUGCUGUCGGUGGG
hsa-miR-181cbrainAACAUUCAACCUGUCGGUGAGU
hsa-miR-181dbrainAACAUUCAUUGUUGUCGGUGGGUU
hsa-miR-181abrainAACAUUCAACGCUGUCGGUGAGU
hsa-miR-181bSZAACAUUCAUUGCUGUCGGUGGG
hsa-miR-181cbrainAACAUUCAACCUGUCGGUGAGU
hsa-miR-181dbrainAACAUUCAUUGUUGUCGGUGGGUU
miR-182433143381A,m8hsa-miR-182UUUGGCAAUGGUAGAACUCACA
miR-18856045610m8hsa-miR-188CAUCCCUUGCAUGGUGGAGGGU
miR-19152915361A,m8hsa-miR-19aUGUGCAAAUCUAUGCAAAACUGA
hsa-miR-19bUGUGCAAAUCCAUGCAAAACUGA
hsa-miR-19aUGUGCAAAUCUAUGCAAAACUGA
hsa-miR-19bUGUGCAAAUCCAUGCAAAACUGA
hsa-miR-19aUGUGCAAAUCUAUGCAAAACUGA
hsa-miR-19bUGUGCAAAUCCAUGCAAAACUGA
hsa-miR-19aUGUGCAAAUCUAUGCAAAACUGA
hsa-miR-19bUGUGCAAAUCCAUGCAAAACUGA
miR-200bc/4297985m8hsa-miR-200bUAAUACUGCCUGGUAAUGAUGAC
hsa-miR-200cUAAUACUGCCGGGUAAUGAUGG
hsa-miR-429UAAUACUGUCUGGUAAAACCGU
hsa-miR-200bUAAUACUGCCUGGUAAUGAUGAC
hsa-miR-200cUAAUACUGCCGGGUAAUGAUGG
hsa-miR-429UAAUACUGUCUGGUAAAACCGU
miR-21848474853m8hsa-miR-218brainUUGUGCUUGAUCUAACCAUGU
miR-219361736231Ahsa-miR-219brainUGAUUGUCCAAACGCAAUUCU
miR-221/222162616331A,m8hsa-miR-221brainAGCUACAUUGUCUGCUGGGUUUC
hsa-miR-222brainAGCUACAUCUGGCUACUGGGUCUC
miR-23132513321A,m8hsa-miR-23abrainAUCACAUUGCCAGGGAUUUCC
hsa-miR-23bbrainAUCACAUUGCCAGGGAUUACC
miR-25/32/92/363/367424042461Ahsa-miR-25brainCAUUGCACUUGUCUCGGUCUGA
hsa-miR-32UAUUGCACAUUACUAAGUUGC
hsa-miR-92UAUUGCACUUGUCCCGGCCUG
hsa-miR-367AAUUGCACUUUAGCAAUGGUGA
hsa-miR-92bSZUAUUGCACUCGUCCCGGCCUC
miR-28427442811A,m8hsa-miR-28brainAAGGAGCUCACAGUCUAUUGAG
miR-2970567062m8hsa-miR-29aSZUAGCACCAUCUGAAAUCGGUU
hsa-miR-29bSZUAGCACCAUUUGAAAUCAGUGUU
hsa-miR-29cSZUAGCACCAUUUGAAAUCGGU
miR-30-3p43204326m8hsa-miR-30a-3pCUUUCAGUCGGAUGUUUGCAGC
hsa-miR-30e-3pCUUUCAGUCGGAUGUUUACAGC
miR-30-5p624962561A,m8hsa-miR-30a-5pUGUAAACAUCCUCGACUGGAAG
hsa-miR-30cbrainUGUAAACAUCCUACACUCUCAGC
hsa-miR-30dSZUGUAAACAUCCCCGACUGGAAG
hsa-miR-30bSZUGUAAACAUCCUACACUCAGCU
hsa-miR-30e-5pUGUAAACAUCCUUGACUGGA
hsa-miR-30a-5pUGUAAACAUCCUCGACUGGAAG
hsa-miR-30cbrainUGUAAACAUCCUACACUCUCAGC
hsa-miR-30dSZUGUAAACAUCCCCGACUGGAAG
hsa-miR-30bSZUGUAAACAUCCUACACUCAGCU
hsa-miR-30e-5pUGUAAACAUCCUUGACUGGA
miR-32033273333m8hsa-miR-320AAAAGCUGGGUUGAGAGGGCGAA
miR-323132513311Ahsa-miR-323brainGCACAUUACACGGUCGACCUCU
miR-326196719741A,m8hsa-miR-326CCUCUGGGCCCUUCCUCCAG
miR-32969936999m8hsa-miR-329brainAACACACCUGGUUAACCUCUUU
miR-34b164916551Ahsa-miR-34bUAGGCAGUGUCAUUAGCUGAUUG
miR-369-3p709370991Ahsa-miR-369-3pAAUAAUACAUGGUUGAUCUUU
miR-37035883594m8hsa-miR-370brainGCCUGCUGGGGUGGAACCUGG
miR-374709371001A,m8hsa-miR-374UUAUAAUACAACCUGAUAAGUG
miR-375712671321Ahsa-miR-375UUUGUUCGUUCGGCUCGCGUGA
miR-37715531559m8hsa-miR-377AUCACACAAAGGCAACUUUUGU
miR-3848758811Ahsa-miR-384AUUCCUAGAAAUUGUUCAUA
miR-493-5p417341791Ahsa-miR-493-5pUUGUACAUGGUAGGCUUUCAUU
miR-495538153871Ahsa-miR-495brainAAACAAACAUGGUGCACUUCUUU
miR-542-3p171917261A,m8hsa-miR-542-3pUGUGACAGAUUGAUAACUGAAA
miR-54341874193m8hsa-miR-543AAACAUUCGCGGUGCACUUCU
miR-7612161281A,m8hsa-miR-7SZUGGAAGACUAGUGAUUUUGUUG
miR-9556755731Ahsa-miR-9SZUCUUUGGUUAUCUAGCUGUAUGA
miR-93.hd/291-3p/294/295/302/372/373/52041464152m8hsa-miR-93brainAAAGUGCUGUUCGUGCAGGUAG
hsa-miR-302aUAAGUGCUUCCAUGUUUUGGUGA
hsa-miR-302bUAAGUGCUUCCAUGUUUUAGUAG
hsa-miR-302cUAAGUGCUUCCAUGUUUCAGUGG
hsa-miR-302dUAAGUGCUUCCAUGUUUGAGUGU
hsa-miR-372AAAGUGCUGCGACAUUUGAGCGU
hsa-miR-373GAAGUGCUUCGAUUUUGGGGUGU
hsa-miR-520eAAAGUGCUUCCUUUUUGAGGG
hsa-miR-520aAAAGUGCUUCCCUUUGGACUGU
hsa-miR-520bAAAGUGCUUCCUUUUAGAGGG
hsa-miR-520cAAAGUGCUUCCUUUUAGAGGGUU
hsa-miR-520dAAAGUGCUUCUCUUUGGUGGGUU
miR-9672067212m8hsa-miR-96brainUUUGGCACUAGCACAUUUUUGC
hsa-miR-96brainUUUGGCACUAGCACAUUUUUGC
hsa-miR-96brainUUUGGCACUAGCACAUUUUUGC