SZGR2

Summary ?

GeneID	6311
Symbol	ATXN2
Synonyms	ASL13\|ATX2\|SCA2\|TNRC13
Description	ataxin 2
Reference	MIM:601517\|HGNC:HGNC:10555\|Ensembl:ENSG00000204842\|HPRD:03307\|Vega:OTTHUMG00000133475
Gene type	protein-coding
Map location	12q24.1
Pascal p-value	0.308
Sherlock p-value	0.143
Fetal beta	0.077
eGene	Myers' cis & trans

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
CV:PheWAS	Phenome-wide association studies (PheWAS)	157 SNPs associated with schizophrenia	0
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias	Click to show details
Network	Shortest path distance of core genes in the Human protein-protein interaction network	Contribution to shortest path in PPI network: 0.02

Section I. Genetics and epigenetics annotation

CV:PheWAS

SNP ID	Chromosome	Position	Allele	P	Function	Gene	Up/Down Distance

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	pvalue	qvalue	TSS distance	eQTL type
rs6128541	chr20	57917688	ATXN2	6311		0.1		trans
rs1964825	chr20	57919515	ATXN2	6311		0.18		trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0003723	RNA binding	NAS		10814712
GO:0008022	protein C-terminus binding	IPI		15663938
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0006417	regulation of translation	NAS		16835262
GO:0016070	RNA metabolic process	NAS		15663938
GO:0008219	cell death	IEA		-
GO:0034063	stress granule assembly	IMP		17392519
GO:0033962	cytoplasmic mRNA processing body assembly	IMP		17392519
GO:0050658	RNA transport	NAS		10814712
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005794	Golgi apparatus	IDA		12812977 \|17097639
GO:0005802	trans-Golgi network	IDA		10814712
GO:0005844	polysome	IDA		16835262
GO:0005737	cytoplasm	IDA		10814712 \|17392519
GO:0010494	stress granule	IDA		17392519
GO:0048471	perinuclear region of cytoplasm	IDA		17097639

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
ENK UV RESPONSE KERATINOCYTE DN	485	334	All SZGR 2.0 genes in this pathway
BERENJENO ROCK SIGNALING NOT VIA RHOA DN	48	34	All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN	1781	1082	All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 DN	855	609	All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 COMMON DN	483	336	All SZGR 2.0 genes in this pathway
MARTORIATI MDM4 TARGETS FETAL LIVER DN	514	319	All SZGR 2.0 genes in this pathway
UEDA PERIFERAL CLOCK	169	111	All SZGR 2.0 genes in this pathway
GUO HEX TARGETS UP	81	54	All SZGR 2.0 genes in this pathway
TAKAO RESPONSE TO UVB RADIATION DN	98	67	All SZGR 2.0 genes in this pathway
STEARMAN LUNG CANCER EARLY VS LATE UP	125	89	All SZGR 2.0 genes in this pathway
ACEVEDO LIVER CANCER DN	540	340	All SZGR 2.0 genes in this pathway
SHEDDEN LUNG CANCER GOOD SURVIVAL A4	196	124	All SZGR 2.0 genes in this pathway
BYSTRYKH HEMATOPOIESIS STEM CELL SCP2 QTL TRANS	25	13	All SZGR 2.0 genes in this pathway
CHANDRAN METASTASIS UP	221	135	All SZGR 2.0 genes in this pathway
GUO TARGETS OF IRS1 AND IRS2	98	67	All SZGR 2.0 genes in this pathway
PLASARI TGFB1 SIGNALING VIA NFIC 1HR DN	106	77	All SZGR 2.0 genes in this pathway
DELACROIX RARG BOUND MEF	367	231	All SZGR 2.0 genes in this pathway
DELACROIX RAR BOUND ES	462	273	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-145	265	272	1A,m8	hsa-miR-145	GUCCAGUUUUCCCAGGAAUCCCUU
miR-15/16/195/424/497	346	353	1A,m8	hsa-miR-15a^brain	UAGCAGCACAUAAUGGUUUGUG
				hsa-miR-16^brain	UAGCAGCACGUAAAUAUUGGCG
				hsa-miR-15b^brain	UAGCAGCACAUCAUGGUUUACA
				hsa-miR-195^SZ	UAGCAGCACAGAAAUAUUGGC
				hsa-miR-424	CAGCAGCAAUUCAUGUUUUGAA
				hsa-miR-497	CAGCAGCACACUGUGGUUUGU
miR-204/211	516	522	1A	hsa-miR-204^brain	UUCCCUUUGUCAUCCUAUGCCU
miR-204/211	516	522	1A	hsa-miR-211	UUCCCUUUGUCAUCCUUCGCCU
miR-218	64	70	m8	hsa-miR-218^brain	UUGUGCUUGAUCUAACCAUGU
miR-433-3p	302	308	1A	hsa-miR-433^brain	AUCAUGAUGGGCUCCUCGGUGU
miR-503	347	353	1A	hsa-miR-503	UAGCAGCGGGAACAGUUCUGCAG

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: ATXN2