SZGR2

Summary ?

GeneID	63973
Symbol	NEUROG2
Synonyms	Atoh4\|Math4A\|NGN2\|bHLHa8\|ngn-2
Description	neurogenin 2
Reference	MIM:606624\|HGNC:HGNC:13805\|Ensembl:ENSG00000178403\|HPRD:06976\|Vega:OTTHUMG00000132907
Gene type	protein-coding
Map location	4q25
Pascal p-value	0.725
Fetal beta	6.331
DMG	1 (# studies)
eGene	Myers' cis & trans

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
DMG:Jaffe_2016	Genome-wide DNA methylation analysis	This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05.	1
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias	Click to show details
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 5

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg09707262	4	113438462	NEUROG2	5.09E-8	-0.011	1.35E-5	DMG:Jaffe_2016

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	pvalue	qvalue	TSS distance	eQTL type
rs1507047	chr16	50932778	NEUROG2	63973		0.19		trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0003677	DNA binding	IEA		-
GO:0005515	protein binding	IEA		-
GO:0030528	transcription regulator activity	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0007411	axon guidance	IEA	axon (GO term level: 13)	-
GO:0001764	neuron migration	IEA	neuron (GO term level: 8)	-
GO:0030182	neuron differentiation	IEA	neuron (GO term level: 8)	-
GO:0030900	forebrain development	IEA	Brain (GO term level: 8)	-
GO:0007399	nervous system development	IEA	neurite (GO term level: 5)	-
GO:0006355	regulation of transcription, DNA-dependent	IEA		-
GO:0007275	multicellular organismal development	IEA		-
GO:0045165	cell fate commitment	IEA		-
GO:0045944	positive regulation of transcription from RNA polymerase II promoter	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005634	nucleus	IEA		-

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
BENPORATH SUZ12 TARGETS	1038	678	All SZGR 2.0 genes in this pathway
BENPORATH EED TARGETS	1062	725	All SZGR 2.0 genes in this pathway
BENPORATH ES WITH H3K27ME3	1118	744	All SZGR 2.0 genes in this pathway
BENPORATH PRC2 TARGETS	652	441	All SZGR 2.0 genes in this pathway
MODY HIPPOCAMPUS PRENATAL	42	33	All SZGR 2.0 genes in this pathway
CAMPS COLON CANCER COPY NUMBER UP	92	45	All SZGR 2.0 genes in this pathway
MEISSNER NPC HCP WITH H3K4ME3 AND H3K27ME3	142	103	All SZGR 2.0 genes in this pathway
MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3	1069	729	All SZGR 2.0 genes in this pathway
MIKKELSEN NPC HCP WITH H3K4ME3 AND H3K27ME3	210	148	All SZGR 2.0 genes in this pathway
MARTENS TRETINOIN RESPONSE UP	857	456	All SZGR 2.0 genes in this pathway
CARD MIR302A TARGETS	77	62	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-17-5p/20/93.mr/106/519.d	602	608	m8	hsa-miR-17-5p	CAAAGUGCUUACAGUGCAGGUAGU
				hsa-miR-20a^brain	UAAAGUGCUUAUAGUGCAGGUAG
				hsa-miR-106a	AAAAGUGCUUACAGUGCAGGUAGC
				hsa-miR-106b^SZ	UAAAGUGCUGACAGUGCAGAU
				hsa-miR-20b^SZ	CAAAGUGCUCAUAGUGCAGGUAG
				hsa-miR-519d	CAAAGUGCCUCCCUUUAGAGUGU
miR-187	954	960	m8	hsa-miR-187	UCGUGUCUUGUGUUGCAGCCG
miR-216	917	923	1A	hsa-miR-216	UAAUCUCAGCUGGCAACUGUG
miR-30-3p	940	946	1A	hsa-miR-30a-3p	CUUUCAGUCGGAUGUUUGCAGC
miR-30-3p	940	946	1A	hsa-miR-30e-3p	CUUUCAGUCGGAUGUUUACAGC
miR-33	776	782	1A	hsa-miR-33	GUGCAUUGUAGUUGCAUUG
				hsa-miR-33b	GUGCAUUGCUGUUGCAUUGCA
				hsa-miR-33	GUGCAUUGUAGUUGCAUUG
				hsa-miR-33b	GUGCAUUGCUGUUGCAUUGCA
miR-346	952	958	1A	hsa-miR-346^brain	UGUCUGCCCGCAUGCCUGCCUCU
miR-377	374	380	1A	hsa-miR-377	AUCACACAAAGGCAACUUUUGU
miR-381	746	752	1A	hsa-miR-381	UAUACAAGGGCAAGCUCUCUGU
miR-381	746	752	1A	hsa-miR-381	UAUACAAGGGCAAGCUCUCUGU
miR-490	732	738	1A	hsa-miR-490	CAACCUGGAGGACUCCAUGCUG
miR-495	719	725	1A	hsa-miR-495^brain	AAACAAACAUGGUGCACUUCUUU

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: NEUROG2