Gene Page: ABCG4
Summary ?
| GeneID | 64137 |
| Symbol | ABCG4 |
| Synonyms | WHITE2 |
| Description | ATP binding cassette subfamily G member 4 |
| Reference | MIM:607784|HGNC:HGNC:13884|Ensembl:ENSG00000172350|HPRD:12130|Vega:OTTHUMG00000166169 |
| Gene type | protein-coding |
| Map location | 11q23.3 |
| Pascal p-value | 0.08 |
| Sherlock p-value | 0.024 |
| TADA p-value | 0.014 |
| Fetal beta | -0.773 |
| DMG | 1 (# studies) |
| Support | CompositeSet |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 1 |
| DNM:Xu_2012 | Whole Exome Sequencing analysis | De novo mutations of 4 genes were identified by exome sequencing of 795 samples in this study | |
| GSMA_I | Genome scan meta-analysis | Psr: 0.006 |
Section I. Genetics and epigenetics annotation
DNM table
| Gene | Chromosome | Position | Ref | Alt | Transcript | AA change | Mutation type | Sift | CG46 | Trait | Study |
|---|---|---|---|---|---|---|---|---|---|---|---|
| ABCG4 | chr11 | 119024831 | A | G | NM_001142505 NM_022169 | p.112M>V p.112M>V | missense missense | Schizophrenia | DNM:Xu_2012 |
Differentially methylated gene
| Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
|---|---|---|---|---|---|---|---|
| cg25223263 | 11 | 119020168 | ABCG4 | 7.9E-5 | -0.211 | 0.025 | DMG:Wockner_2014 |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0000166 | nucleotide binding | IEA | - | |
| GO:0005524 | ATP binding | IEA | - | |
| GO:0016887 | ATPase activity | IEA | - | |
| GO:0042803 | protein homodimerization activity | IDA | 16870176 | |
| GO:0046982 | protein heterodimerization activity | IPI | 16870176 | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0006810 | transport | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0016020 | membrane | IEA | - | |
| GO:0016021 | integral to membrane | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| KEGG ABC TRANSPORTERS | 44 | 29 | All SZGR 2.0 genes in this pathway |
| REACTOME ABCA TRANSPORTERS IN LIPID HOMEOSTASIS | 18 | 11 | All SZGR 2.0 genes in this pathway |
| REACTOME ABC FAMILY PROTEINS MEDIATED TRANSPORT | 34 | 21 | All SZGR 2.0 genes in this pathway |
| REACTOME TRANSMEMBRANE TRANSPORT OF SMALL MOLECULES | 413 | 270 | All SZGR 2.0 genes in this pathway |
| LASTOWSKA NEUROBLASTOMA COPY NUMBER DN | 800 | 473 | All SZGR 2.0 genes in this pathway |
| HATADA METHYLATED IN LUNG CANCER UP | 390 | 236 | All SZGR 2.0 genes in this pathway |
| BENPORATH SUZ12 TARGETS | 1038 | 678 | All SZGR 2.0 genes in this pathway |
| BENPORATH ES WITH H3K27ME3 | 1118 | 744 | All SZGR 2.0 genes in this pathway |
| MOREAUX MULTIPLE MYELOMA BY TACI UP | 412 | 249 | All SZGR 2.0 genes in this pathway |
| MEISSNER NPC HCP WITH H3 UNMETHYLATED | 536 | 296 | All SZGR 2.0 genes in this pathway |
| MIKKELSEN MCV6 HCP WITH H3K27ME3 | 435 | 318 | All SZGR 2.0 genes in this pathway |
| STEIN ESR1 TARGETS | 85 | 55 | All SZGR 2.0 genes in this pathway |
| CHYLA CBFA2T3 TARGETS DN | 242 | 146 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-142-5p | 755 | 761 | m8 | hsa-miR-142-5p | CAUAAAGUAGAAAGCACUAC |
| miR-15/16/195/424/497 | 1238 | 1244 | m8 | hsa-miR-15abrain | UAGCAGCACAUAAUGGUUUGUG |
| hsa-miR-16brain | UAGCAGCACGUAAAUAUUGGCG | ||||
| hsa-miR-15bbrain | UAGCAGCACAUCAUGGUUUACA | ||||
| hsa-miR-195SZ | UAGCAGCACAGAAAUAUUGGC | ||||
| hsa-miR-424 | CAGCAGCAAUUCAUGUUUUGAA | ||||
| hsa-miR-497 | CAGCAGCACACUGUGGUUUGU | ||||
| miR-25/32/92/363/367 | 703 | 710 | 1A,m8 | hsa-miR-25brain | CAUUGCACUUGUCUCGGUCUGA |
| hsa-miR-32 | UAUUGCACAUUACUAAGUUGC | ||||
| hsa-miR-92 | UAUUGCACUUGUCCCGGCCUG | ||||
| hsa-miR-367 | AAUUGCACUUUAGCAAUGGUGA | ||||
| hsa-miR-92bSZ | UAUUGCACUCGUCCCGGCCUC | ||||
| miR-7 | 209 | 215 | m8 | hsa-miR-7SZ | UGGAAGACUAGUGAUUUUGUUG |
| hsa-miR-7SZ | UGGAAGACUAGUGAUUUUGUUG | ||||
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.