SZGR2

Summary ?

GeneID	64319
Symbol	FBRS
Synonyms	FBS\|FBS1
Description	fibrosin
Reference	MIM:608601\|HGNC:HGNC:20442\|Ensembl:ENSG00000156860\|HPRD:16354\|Vega:OTTHUMG00000132390
Gene type	protein-coding
Map location	16p11.2
Pascal p-value	0.093
Sherlock p-value	0.004
Fetal beta	-0.572
DMG	1 (# studies)

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
DMG:Jaffe_2016	Genome-wide DNA methylation analysis	This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05.	2
GSMA_IIE	Genome scan meta-analysis (European-ancestry samples)	Psr: 0.01775

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg01566527	16	30669819	FBRS	4.61E-9	-0.008	2.69E-6	DMG:Jaffe_2016
cg04342090	16	30670571	FBRS	2.71E-8	-0.008	8.56E-6	DMG:Jaffe_2016

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
RASHI RESPONSE TO IONIZING RADIATION 3	48	31	All SZGR 2.0 genes in this pathway
LIN APC TARGETS	77	55	All SZGR 2.0 genes in this pathway
MARSON BOUND BY FOXP3 STIMULATED	1022	619	All SZGR 2.0 genes in this pathway
MARSON BOUND BY FOXP3 UNSTIMULATED	1229	713	All SZGR 2.0 genes in this pathway
GRADE COLON CANCER UP	871	505	All SZGR 2.0 genes in this pathway
MOOTHA PGC	420	269	All SZGR 2.0 genes in this pathway
SHEDDEN LUNG CANCER GOOD SURVIVAL A5	70	32	All SZGR 2.0 genes in this pathway
HOSHIDA LIVER CANCER SUBCLASS S1	237	159	All SZGR 2.0 genes in this pathway
PILON KLF1 TARGETS DN	1972	1213	All SZGR 2.0 genes in this pathway
BRUINS UVC RESPONSE VIA TP53 GROUP B	549	316	All SZGR 2.0 genes in this pathway
BRUINS UVC RESPONSE MIDDLE	98	56	All SZGR 2.0 genes in this pathway
PHONG TNF RESPONSE VIA P38 COMPLETE	227	151	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-141/200a	1151	1157	1A	hsa-miR-141	UAACACUGUCUGGUAAAGAUGG
miR-141/200a	1151	1157	1A	hsa-miR-200a	UAACACUGUCUGGUAACGAUGU
miR-149	340	346	1A	hsa-miR-149^brain	UCUGGCUCCGUGUCUUCACUCC
miR-194	1153	1159	1A	hsa-miR-194	UGUAACAGCAACUCCAUGUGGA
miR-22	975	981	m8	hsa-miR-22^brain	AAGCUGCCAGUUGAAGAACUGU
miR-29	543	549	m8	hsa-miR-29a^SZ	UAGCACCAUCUGAAAUCGGUU
				hsa-miR-29b^SZ	UAGCACCAUUUGAAAUCAGUGUU
				hsa-miR-29c^SZ	UAGCACCAUUUGAAAUCGGU
miR-370	1023	1029	m8	hsa-miR-370^brain	GCCUGCUGGGGUGGAACCUGG
miR-410	1138	1144	1A	hsa-miR-410	AAUAUAACACAGAUGGCCUGU
miR-493-5p	437	443	m8	hsa-miR-493-5p	UUGUACAUGGUAGGCUUUCAUU
miR-9	938	945	1A,m8	hsa-miR-9^SZ	UCUUUGGUUAUCUAGCUGUAUGA

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: FBRS