Gene Page: CHST8
Summary ?
GeneID | 64377 |
Symbol | CHST8 |
Synonyms | GALNAC4ST1|GalNAc4ST|PSS3 |
Description | carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 8 |
Reference | MIM:610190|HGNC:HGNC:15993|Ensembl:ENSG00000124302|HPRD:07632|Vega:OTTHUMG00000180472 |
Gene type | protein-coding |
Map location | 19q13.1 |
Pascal p-value | 0.452 |
Fetal beta | -1.243 |
DMG | 1 (# studies) |
eGene | Caudate basal ganglia |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:GWAScat | Genome-wide Association Studies | This data set includes 560 SNPs associated with schizophrenia. A total of 486 genes were mapped to these SNPs within 50kb. | |
CV:GWASdb | Genome-wide Association Studies | GWASdb records for schizophrenia | |
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 1 |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg08135503 | 19 | 34177741 | CHST8 | 3.273E-4 | 0.491 | 0.04 | DMG:Wockner_2014 |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0001537 | N-acetylgalactosamine 4-O-sulfotransferase activity | IDA | 10988300 |11001942 |11445554 | |
GO:0016740 | transferase activity | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0007417 | central nervous system development | NAS | Brain (GO term level: 6) | 10988300 |
GO:0005975 | carbohydrate metabolic process | IEA | - | |
GO:0042446 | hormone biosynthetic process | IEP | 10988300 | |
GO:0030166 | proteoglycan biosynthetic process | IDA | 10988300 | |
GO:0006790 | sulfur metabolic process | IDA | 11445554 | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0000139 | Golgi membrane | IEA | - | |
GO:0005794 | Golgi apparatus | IEA | - | |
GO:0016020 | membrane | IEA | - | |
GO:0016021 | integral to membrane | NAS | 10988300 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
DAVICIONI MOLECULAR ARMS VS ERMS UP | 332 | 228 | All SZGR 2.0 genes in this pathway |
PEPPER CHRONIC LYMPHOCYTIC LEUKEMIA DN | 21 | 8 | All SZGR 2.0 genes in this pathway |
BENPORATH SUZ12 TARGETS | 1038 | 678 | All SZGR 2.0 genes in this pathway |
BENPORATH EED TARGETS | 1062 | 725 | All SZGR 2.0 genes in this pathway |
BENPORATH ES WITH H3K27ME3 | 1118 | 744 | All SZGR 2.0 genes in this pathway |
BENPORATH PRC2 TARGETS | 652 | 441 | All SZGR 2.0 genes in this pathway |
RIGGINS TAMOXIFEN RESISTANCE UP | 66 | 44 | All SZGR 2.0 genes in this pathway |
WANG LSD1 TARGETS DN | 39 | 30 | All SZGR 2.0 genes in this pathway |
SMID BREAST CANCER RELAPSE IN BRAIN DN | 85 | 58 | All SZGR 2.0 genes in this pathway |
BONOME OVARIAN CANCER SURVIVAL SUBOPTIMAL DEBULKING | 510 | 309 | All SZGR 2.0 genes in this pathway |
GRADE COLON AND RECTAL CANCER DN | 101 | 65 | All SZGR 2.0 genes in this pathway |
MEISSNER NPC HCP WITH H3K4ME3 AND H3K27ME3 | 142 | 103 | All SZGR 2.0 genes in this pathway |
MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3 | 1069 | 729 | All SZGR 2.0 genes in this pathway |
MIKKELSEN NPC HCP WITH H3K4ME3 AND H3K27ME3 | 210 | 148 | All SZGR 2.0 genes in this pathway |
MARTENS TRETINOIN RESPONSE UP | 857 | 456 | All SZGR 2.0 genes in this pathway |
PANGAS TUMOR SUPPRESSION BY SMAD1 AND SMAD5 DN | 157 | 106 | All SZGR 2.0 genes in this pathway |
BHAT ESR1 TARGETS NOT VIA AKT1 UP | 211 | 131 | All SZGR 2.0 genes in this pathway |
BHAT ESR1 TARGETS VIA AKT1 UP | 281 | 183 | All SZGR 2.0 genes in this pathway |
WAKABAYASHI ADIPOGENESIS PPARG BOUND 8D | 658 | 397 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-218 | 426 | 432 | m8 | hsa-miR-218brain | UUGUGCUUGAUCUAACCAUGU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.