SZGR2

Summary ?

GeneID	64400
Symbol	AKTIP
Synonyms	FT1\|FTS
Description	AKT interacting protein
Reference	MIM:608483\|HGNC:HGNC:16710\|Ensembl:ENSG00000166971\|HPRD:07467\|Vega:OTTHUMG00000133199
Gene type	protein-coding
Map location	16q12.2
Pascal p-value	0.005
Sherlock p-value	0.342
TADA p-value	0.008
Fetal beta	0.72
eGene	Meta
Support	CompositeSet

Gene in Data Sources

Gene set name	Method of gene set	Description
CV:PGCnp	Genome-wide Association Study	GWAS
DNM:Fromer_2014	Whole Exome Sequencing analysis	This study reported a WES study of 623 schizophrenia trios, reporting DNMs using genomic DNA.
Network	Shortest path distance of core genes in the Human protein-protein interaction network	Contribution to shortest path in PPI network: 0.0078

Section I. Genetics and epigenetics annotation

DNM table

Gene	Chromosome	Position	Ref	Alt	Transcript	AA change	Mutation type	Sift	CG46	Trait	Study
AKTIP	chr16	53528433	A	G	NM_001012398 NM_001012398 NM_022476 NM_022476	. p.167W>R . p.167W>R	splice missense splice missense			Schizophrenia	DNM:Fromer_2014

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005515	protein binding	IPI		14749367
GO:0019787	small conjugating protein ligase activity	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0001934	positive regulation of protein amino acid phosphorylation	IDA		14749367
GO:0032092	positive regulation of protein binding	IDA		14749367
GO:0051246	regulation of protein metabolic process	IEA		-
GO:0043687	post-translational protein modification	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005886	plasma membrane	IDA		14749367

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
AKT1	AKT \| MGC99656 \| PKB \| PKB-ALPHA \| PRKBA \| RAC \| RAC-ALPHA	v-akt murine thymoma viral oncogene homolog 1	-	HPRD,BioGRID	14749367
ASS1	ASS \| CTLN1	argininosuccinate synthetase 1	Two-hybrid	BioGRID	16169070
C10orf2	ATXN8 \| FLJ21832 \| IOSCA \| PEO \| PEO1 \| PEOA3 \| SANDO \| SCA8 \| TWINL	chromosome 10 open reading frame 2	Two-hybrid	BioGRID	16169070
CTBP2	-	C-terminal binding protein 2	Two-hybrid	BioGRID	16189514
DCTN1	DAP-150 \| DP-150 \| HMN7B \| P135	dynactin 1 (p150, glued homolog, Drosophila)	Affinity Capture-MS	BioGRID	17353931
EXOC7	2-5-3p \| DKFZp686J04253 \| EX070 \| EXO70 \| EXOC1 \| Exo70p \| FLJ40965 \| FLJ46415 \| YJL085W	exocyst complex component 7	Two-hybrid	BioGRID	16169070
GTF3C1	DKFZp686A111 \| TFIIIC \| TFIIIC220 \| TFIIICalpha	general transcription factor IIIC, polypeptide 1, alpha 220kDa	Two-hybrid	BioGRID	16169070
HDLBP	FLJ16432 \| HBP \| PRO2900 \| VGL	high density lipoprotein binding protein	Affinity Capture-MS	BioGRID	17353931
HOOK1	HK1 \| MGC10642	hook homolog 1 (Drosophila)	Affinity Capture-MS	BioGRID	17353931
HOOK2	FLJ26218 \| HK2	hook homolog 2 (Drosophila)	Two-hybrid	BioGRID	16189514
IARS	FLJ20736 \| IARS1 \| ILRS \| PRO0785	isoleucyl-tRNA synthetase	Affinity Capture-MS	BioGRID	17353931
IMMT	DKFZp779P1653 \| HMP \| MGC111146 \| P87 \| P87/89 \| P89 \| PIG4 \| PIG52	inner membrane protein, mitochondrial (mitofilin)	Two-hybrid	BioGRID	16169070
KIAA1377	-	KIAA1377	Two-hybrid	BioGRID	16169070
PDPK1	MGC20087 \| MGC35290 \| PDK1 \| PRO0461	3-phosphoinositide dependent protein kinase-1	-	HPRD	14749367
PDS5A	DKFZp686B19246 \| FLJ41012 \| KIAA0648 \| MGC131948 \| MGC161503 \| PIG54 \| SCC-112	PDS5, regulator of cohesion maintenance, homolog A (S. cerevisiae)	Affinity Capture-MS	BioGRID	17353931
POLA2	FLJ21662 \| FLJ37250	polymerase (DNA directed), alpha 2 (70kD subunit)	Two-hybrid	BioGRID	16169070
RPA1	HSSB \| REPA1 \| RF-A \| RP-A \| RPA70	replication protein A1, 70kDa	Two-hybrid	BioGRID	16169070
TIMM50	MGC102733 \| TIM50 \| TIM50L	translocase of inner mitochondrial membrane 50 homolog (S. cerevisiae)	Affinity Capture-MS	BioGRID	17353931
UTP14A	KIAA0266 \| NY-CO-16 \| SDCCAG16 \| dJ537K23.3	UTP14, U3 small nucleolar ribonucleoprotein, homolog A (yeast)	Two-hybrid	BioGRID	16169070

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
DAVICIONI MOLECULAR ARMS VS ERMS UP	332	228	All SZGR 2.0 genes in this pathway
TIEN INTESTINE PROBIOTICS 6HR DN	167	100	All SZGR 2.0 genes in this pathway
COLDREN GEFITINIB RESISTANCE DN	230	115	All SZGR 2.0 genes in this pathway
ROYLANCE BREAST CANCER 16Q COPY NUMBER UP	63	44	All SZGR 2.0 genes in this pathway
PEREZ TP53 TARGETS	1174	695	All SZGR 2.0 genes in this pathway
EBAUER TARGETS OF PAX3 FOXO1 FUSION DN	48	31	All SZGR 2.0 genes in this pathway
KIM MYCN AMPLIFICATION TARGETS DN	103	59	All SZGR 2.0 genes in this pathway
SCHAEFFER PROSTATE DEVELOPMENT 6HR DN	514	330	All SZGR 2.0 genes in this pathway
SHEN SMARCA2 TARGETS UP	424	268	All SZGR 2.0 genes in this pathway
BYSTRYKH HEMATOPOIESIS STEM CELL QTL TRANS	882	572	All SZGR 2.0 genes in this pathway
GUO HEX TARGETS UP	81	54	All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE DN	1237	837	All SZGR 2.0 genes in this pathway
YAMAZAKI TCEB3 TARGETS DN	215	132	All SZGR 2.0 genes in this pathway
BURTON ADIPOGENESIS 11	57	40	All SZGR 2.0 genes in this pathway
KRIGE RESPONSE TO TOSEDOSTAT 6HR UP	953	554	All SZGR 2.0 genes in this pathway
KRIGE RESPONSE TO TOSEDOSTAT 24HR UP	783	442	All SZGR 2.0 genes in this pathway
CREIGHTON ENDOCRINE THERAPY RESISTANCE 5	482	296	All SZGR 2.0 genes in this pathway
MASSARWEH TAMOXIFEN RESISTANCE UP	578	341	All SZGR 2.0 genes in this pathway
IWANAGA CARCINOGENESIS BY KRAS DN	120	81	All SZGR 2.0 genes in this pathway
MITSIADES RESPONSE TO APLIDIN UP	439	257	All SZGR 2.0 genes in this pathway
BOCHKIS FOXA2 TARGETS	425	261	All SZGR 2.0 genes in this pathway
WONG ADULT TISSUE STEM MODULE	721	492	All SZGR 2.0 genes in this pathway
YAO TEMPORAL RESPONSE TO PROGESTERONE CLUSTER 9	76	45	All SZGR 2.0 genes in this pathway
IVANOVSKA MIR106B TARGETS	90	56	All SZGR 2.0 genes in this pathway
LINSLEY MIR16 TARGETS	206	127	All SZGR 2.0 genes in this pathway
WAKABAYASHI ADIPOGENESIS PPARG BOUND 8D	658	397	All SZGR 2.0 genes in this pathway
KUMAR PATHOGEN LOAD BY MACROPHAGES	275	155	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-101	589	595	1A	hsa-miR-101	UACAGUACUGUGAUAACUGAAG
miR-144	589	595	1A	hsa-miR-144	UACAGUAUAGAUGAUGUACUAG
miR-17-5p/20/93.mr/106/519.d	25	31	m8	hsa-miR-17-5p	CAAAGUGCUUACAGUGCAGGUAGU
				hsa-miR-20a^brain	UAAAGUGCUUAUAGUGCAGGUAG
				hsa-miR-106a	AAAAGUGCUUACAGUGCAGGUAGC
				hsa-miR-106b^SZ	UAAAGUGCUGACAGUGCAGAU
				hsa-miR-20b^SZ	CAAAGUGCUCAUAGUGCAGGUAG
				hsa-miR-519d	CAAAGUGCCUCCCUUUAGAGUGU
miR-451	627	633	m8	hsa-miR-451^brain	AAACCGUUACCAUUACUGAGUUU

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: AKTIP