Summary ?
GeneID64506
SymbolCPEB1
SynonymsCPE-BP1|CPEB|CPEB-1|h-CPEB|hCPEB-1
Descriptioncytoplasmic polyadenylation element binding protein 1
ReferenceMIM:607342|HGNC:HGNC:21744|Ensembl:ENSG00000214575|HPRD:09553|
Gene typeprotein-coding
Map location15q25.2
Pascal p-value8.693E-8
eGeneCerebellum
Myers' cis & trans

Gene in Data Sources
Gene set name Method of gene setDescriptionInfo
CV:PGCnpGenome-wide Association StudyGWAS
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 2 

Section I. Genetics and epigenetics annotation

@eQTL annotation

SNP IDChromosomePositioneGeneGene Entrez IDpvalueqvalueTSS distanceeQTL type
rs1324669chr13107872446CPEB1645060.01trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0003723RNA bindingIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006397mRNA processingIEA-
GO:0006417regulation of translationIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0042995cell projectionIEAaxon (GO term level: 4)-
GO:0045211postsynaptic membraneIEASynap, Neurotransmitter (GO term level: 5)-
GO:0045202synapseIEAneuron, Synap, Neurotransmitter, Glial (GO term level: 2)-
GO:0005737cytoplasmIEA-
GO:0005886plasma membraneIEA-
GO:0030054cell junctionIEA-

Section V. Pathway annotation

Pathway namePathway size# SZGR 2.0 genes in pathwayInfo
KEGG OOCYTE MEIOSIS 11479All SZGR 2.0 genes in this pathway
KEGG DORSO VENTRAL AXIS FORMATION 2521All SZGR 2.0 genes in this pathway
KEGG PROGESTERONE MEDIATED OOCYTE MATURATION 8659All SZGR 2.0 genes in this pathway
PID AURORA A PATHWAY 3120All SZGR 2.0 genes in this pathway
DODD NASOPHARYNGEAL CARCINOMA UP 1821933All SZGR 2.0 genes in this pathway
CHEBOTAEV GR TARGETS DN 12073All SZGR 2.0 genes in this pathway
GAUSSMANN MLL AF4 FUSION TARGETS G DN 3518All SZGR 2.0 genes in this pathway
BEGUM TARGETS OF PAX3 FOXO1 FUSION DN 4534All SZGR 2.0 genes in this pathway
COWLING MYCN TARGETS 4327All SZGR 2.0 genes in this pathway
KOYAMA SEMA3B TARGETS DN 411249All SZGR 2.0 genes in this pathway
MATSUDA NATURAL KILLER DIFFERENTIATION 475313All SZGR 2.0 genes in this pathway
AFFAR YY1 TARGETS UP 214133All SZGR 2.0 genes in this pathway
YAMAZAKI TCEB3 TARGETS DN 215132All SZGR 2.0 genes in this pathway
IVANOVA HEMATOPOIESIS STEM CELL AND PROGENITOR 681420All SZGR 2.0 genes in this pathway
MOLENAAR TARGETS OF CCND1 AND CDK4 UP 6748All SZGR 2.0 genes in this pathway
MATZUK MEIOTIC AND DNA REPAIR 3926All SZGR 2.0 genes in this pathway
MATZUK SPERMATOCYTE 7255All SZGR 2.0 genes in this pathway
MELLMAN TUT1 TARGETS DN 4729All SZGR 2.0 genes in this pathway
MEISSNER NPC HCP WITH H3K4ME2 AND H3K27ME3 349234All SZGR 2.0 genes in this pathway
KORKOLA EMBRYONIC CARCINOMA VS SEMINOMA DN 2514All SZGR 2.0 genes in this pathway
MIKKELSEN NPC HCP WITH H3K4ME3 AND H3K27ME3 210148All SZGR 2.0 genes in this pathway
HOELZEL NF1 TARGETS UP 13993All SZGR 2.0 genes in this pathway
BRUINS UVC RESPONSE VIA TP53 GROUP B 549316All SZGR 2.0 genes in this pathway
KASLER HDAC7 TARGETS 1 UP 194133All SZGR 2.0 genes in this pathway
IKEDA MIR1 TARGETS UP 5339All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
let-7/98128812951A,m8hsa-let-7abrainUGAGGUAGUAGGUUGUAUAGUU
hsa-let-7bbrainUGAGGUAGUAGGUUGUGUGGUU
hsa-let-7cbrainUGAGGUAGUAGGUUGUAUGGUU
hsa-let-7dbrainAGAGGUAGUAGGUUGCAUAGU
hsa-let-7ebrainUGAGGUAGGAGGUUGUAUAGU
hsa-let-7fbrainUGAGGUAGUAGAUUGUAUAGUU
hsa-miR-98brainUGAGGUAGUAAGUUGUAUUGUU
hsa-let-7gSZUGAGGUAGUAGUUUGUACAGU
hsa-let-7ibrainUGAGGUAGUAGUUUGUGCUGU
miR-1/206394400m8hsa-miR-1UGGAAUGUAAAGAAGUAUGUA
hsa-miR-206SZUGGAAUGUAAGGAAGUGUGUGG
hsa-miR-613AGGAAUGUUCCUUCUUUGCC
miR-1015275331Ahsa-miR-101UACAGUACUGUGAUAACUGAAG
miR-122617623m8hsa-miR-122aUGGAGUGUGACAAUGGUGUUUGU
miR-124/506463469m8hsa-miR-506UAAGGCACCCUUCUGAGUAGA
hsa-miR-124brainUAAGGCACGCGGUGAAUGCC
miR-130/301859865m8hsa-miR-130abrainCAGUGCAAUGUUAAAAGGGCAU
hsa-miR-301CAGUGCAAUAGUAUUGUCAAAGC
hsa-miR-130bbrainCAGUGCAAUGAUGAAAGGGCAU
hsa-miR-454-3pUAGUGCAAUAUUGCUUAUAGGGUUU
hsa-miR-130abrainCAGUGCAAUGUUAAAAGGGCAU
hsa-miR-301CAGUGCAAUAGUAUUGUCAAAGC
hsa-miR-130bbrainCAGUGCAAUGAUGAAAGGGCAU
hsa-miR-454-3pUAGUGCAAUAUUGCUUAUAGGGUUU
miR-1349069121Ahsa-miR-134brainUGUGACUGGUUGACCAGAGGG
miR-1445275331Ahsa-miR-144UACAGUAUAGAUGAUGUACUAG
miR-145107310791Ahsa-miR-145GUCCAGUUUUCCCAGGAAUCCCUU
miR-182118411901Ahsa-miR-182UUUGGCAAUGGUAGAACUCACA
miR-1834544601Ahsa-miR-183UAUGGCACUGGUAGAAUUCACUG
miR-214121512221A,m8hsa-miR-214brainACAGCAGGCACAGACAGGCAG
miR-22671677m8hsa-miR-22brainAAGCUGCCAGUUGAAGAACUGU
miR-25/32/92/363/3674024081Ahsa-miR-25brainCAUUGCACUUGUCUCGGUCUGA
hsa-miR-32UAUUGCACAUUACUAAGUUGC
hsa-miR-92UAUUGCACUUGUCCCGGCCUG
hsa-miR-367AAUUGCACUUUAGCAAUGGUGA
hsa-miR-92bSZUAUUGCACUCGUCCCGGCCUC
miR-299-5p5615671Ahsa-miR-299-5pUGGUUUACCGUCCCACAUACAU
miR-320673679m8hsa-miR-320AAAAGCUGGGUUGAGAGGGCGAA
miR-377127612831A,m8hsa-miR-377AUCACACAAAGGCAACUUUUGU
miR-43113111317m8hsa-miR-431UGUCUUGCAGGCCGUCAUGCA
miR-455136513721A,m8hsa-miR-455UAUGUGCCUUUGGACUACAUCG
miR-485-3p10381044m8hsa-miR-485-3pGUCAUACACGGCUCUCCUCUCU
miR-9118611921Ahsa-miR-9SZUCUUUGGUUAUCUAGCUGUAUGA
miR-93.hd/291-3p/294/295/302/372/373/5208618671Ahsa-miR-93brainAAAGUGCUGUUCGUGCAGGUAG
hsa-miR-302aUAAGUGCUUCCAUGUUUUGGUGA
hsa-miR-302bUAAGUGCUUCCAUGUUUUAGUAG
hsa-miR-302cUAAGUGCUUCCAUGUUUCAGUGG
hsa-miR-302dUAAGUGCUUCCAUGUUUGAGUGU
hsa-miR-372AAAGUGCUGCGACAUUUGAGCGU
hsa-miR-373GAAGUGCUUCGAUUUUGGGGUGU
hsa-miR-520eAAAGUGCUUCCUUUUUGAGGG
hsa-miR-520aAAAGUGCUUCCCUUUGGACUGU
hsa-miR-520bAAAGUGCUUCCUUUUAGAGGG
hsa-miR-520cAAAGUGCUUCCUUUUAGAGGGUU
hsa-miR-520dAAAGUGCUUCUCUUUGGUGGGUU
miR-96118311901A,m8hsa-miR-96brainUUUGGCACUAGCACAUUUUUGC