Summary ?
GeneID64641
SymbolEBF2
SynonymsCOE2|EBF-2|O/E-3|OE-3
Descriptionearly B-cell factor 2
ReferenceMIM:609934|HGNC:HGNC:19090|Ensembl:ENSG00000221818|HPRD:16848|Vega:OTTHUMG00000163838
Gene typeprotein-coding
Map location8p21.2
Pascal p-value0.041

Gene in Data Sources
Gene set name Method of gene setDescriptionInfo
CV:PGCnpGenome-wide Association StudyGWAS
GSMA_IGenome scan meta-analysisPsr: 0.031 
GSMA_IIAGenome scan meta-analysis (All samples)Psr: 0.03086 
GSMA_IIEGenome scan meta-analysis (European-ancestry samples)Psr: 0.00057 

Section I. Genetics and epigenetics annotation


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0003677DNA bindingIEA-
GO:0008270zinc ion bindingIEA-
GO:0030528transcription regulator activityIEA-
GO:0046872metal ion bindingIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006355regulation of transcription, DNA-dependentIEA-
GO:0007275multicellular organismal developmentIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005634nucleusIEA-

Section V. Pathway annotation

Pathway namePathway size# SZGR 2.0 genes in pathwayInfo
MOROSETTI FACIOSCAPULOHUMERAL MUSCULAR DISTROPHY UP 2011All SZGR 2.0 genes in this pathway
DARWICHE SKIN TUMOR PROMOTER DN 185115All SZGR 2.0 genes in this pathway
DARWICHE PAPILLOMA RISK LOW DN 165107All SZGR 2.0 genes in this pathway
DARWICHE PAPILLOMA RISK HIGH DN 180110All SZGR 2.0 genes in this pathway
DARWICHE SQUAMOUS CELL CARCINOMA DN 181107All SZGR 2.0 genes in this pathway
MATSUDA NATURAL KILLER DIFFERENTIATION 475313All SZGR 2.0 genes in this pathway
AFFAR YY1 TARGETS UP 214133All SZGR 2.0 genes in this pathway
MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3 1069729All SZGR 2.0 genes in this pathway
MEISSNER NPC HCP WITH H3K4ME2 491319All SZGR 2.0 genes in this pathway
IKEDA MIR133 TARGETS UP 4327All SZGR 2.0 genes in this pathway
WAKABAYASHI ADIPOGENESIS PPARG RXRA BOUND 8D 882506All SZGR 2.0 genes in this pathway
ZWANG TRANSIENTLY UP BY 2ND EGF PULSE ONLY 1725838All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-104504571A,m8hsa-miR-10aUACCCUGUAGAUCCGAAUUUGUG
hsa-miR-10bUACCCUGUAGAACCGAAUUUGU
miR-13343491Ahsa-miR-133aUUGGUCCCCUUCAACCAGCUGU
hsa-miR-133bUUGGUCCCCUUCAACCAGCUA
miR-186255261m8hsa-miR-186CAAAGAAUUCUCCUUUUGGGCUU
miR-21820261Ahsa-miR-218brainUUGUGCUUGAUCUAACCAUGU
miR-223188194m8hsa-miR-223UGUCAGUUUGUCAAAUACCCC
miR-3754434491Ahsa-miR-375UUUGUUCGUUCGGCUCGCGUGA
miR-3763964031A,m8hsa-miR-376aAUCAUAGAGGAAAAUCCACGU
hsa-miR-376bAUCAUAGAGGAAAAUCCAUGUU
miR-3843673731Ahsa-miR-384AUUCCUAGAAAUUGUUCAUA
miR-4523203261Ahsa-miR-452UGUUUGCAGAGGAAACUGAGAC
miR-4952592651Ahsa-miR-495brainAAACAAACAUGGUGCACUUCUUU
miR-5444294361A,m8hsa-miR-544AUUCUGCAUUUUUAGCAAGU