Summary ?
GeneID64699
SymbolTMPRSS3
SynonymsDFNB10|DFNB8|ECHOS1|TADG12
Descriptiontransmembrane protease, serine 3
ReferenceMIM:605511|HGNC:HGNC:11877|Ensembl:ENSG00000160183|HPRD:05696|Vega:OTTHUMG00000086796
Gene typeprotein-coding
Map location21q22.3
Pascal p-value0.737
Fetal beta-1.278

Gene in Data Sources
Gene set name Method of gene setDescriptionInfo
CV:GWASdbGenome-wide Association StudiesGWASdb records for schizophrenia
CV:PGCnpGenome-wide Association StudyGWAS
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 1 

Section I. Genetics and epigenetics annotation


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0004252serine-type endopeptidase activityNASglutamate (GO term level: 7)11068177 |11137999 
GO:0005044scavenger receptor activityIEA-
GO:0008233peptidase activityIEA-
GO:0017080sodium channel regulator activityIDA12393794 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006508proteolysisNAS11068177 
GO:0007605sensory perception of soundIEA-
GO:0006883cellular sodium ion homeostasisIDA12393794 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005789endoplasmic reticulum membraneIDA12393794 
GO:0005783endoplasmic reticulumIDA16780588 
GO:0016020membraneIEA-
GO:0016021integral to membraneNAS11068177 |11137999 

Section V. Pathway annotation

Pathway namePathway size# SZGR 2.0 genes in pathwayInfo
SENGUPTA NASOPHARYNGEAL CARCINOMA WITH LMP1 DN 17582All SZGR 2.0 genes in this pathway
TURASHVILI BREAST NORMAL DUCTAL VS LOBULAR UP 6840All SZGR 2.0 genes in this pathway
KIM WT1 TARGETS 12HR UP 162116All SZGR 2.0 genes in this pathway
DODD NASOPHARYNGEAL CARCINOMA UP 1821933All SZGR 2.0 genes in this pathway
WOOD EBV EBNA1 TARGETS UP 11071All SZGR 2.0 genes in this pathway
SPIELMAN LYMPHOBLAST EUROPEAN VS ASIAN 2FC DN 2113All SZGR 2.0 genes in this pathway
SPIELMAN LYMPHOBLAST EUROPEAN VS ASIAN DN 584395All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE UP 16911088All SZGR 2.0 genes in this pathway
CREIGHTON ENDOCRINE THERAPY RESISTANCE 1 528324All SZGR 2.0 genes in this pathway
CREIGHTON ENDOCRINE THERAPY RESISTANCE 4 307185All SZGR 2.0 genes in this pathway
HELLER HDAC TARGETS DN 292189All SZGR 2.0 genes in this pathway
MASSARWEH TAMOXIFEN RESISTANCE DN 258160All SZGR 2.0 genes in this pathway
MASSARWEH RESPONSE TO ESTRADIOL 6147All SZGR 2.0 genes in this pathway
CHEN METABOLIC SYNDROM NETWORK 1210725All SZGR 2.0 genes in this pathway
MARTENS TRETINOIN RESPONSE UP 857456All SZGR 2.0 genes in this pathway
BHAT ESR1 TARGETS NOT VIA AKT1 UP 211131All SZGR 2.0 genes in this pathway
PEDERSEN METASTASIS BY ERBB2 ISOFORM 7 403240All SZGR 2.0 genes in this pathway
ZWANG TRANSIENTLY UP BY 2ND EGF PULSE ONLY 1725838All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-29818824m8hsa-miR-29aSZUAGCACCAUCUGAAAUCGGUU
hsa-miR-29bSZUAGCACCAUUUGAAAUCAGUGUU
hsa-miR-29cSZUAGCACCAUUUGAAAUCGGU