Gene Page: SIAH1
Summary ?
| GeneID | 6477 |
| Symbol | SIAH1 |
| Synonyms | SIAH1A |
| Description | siah E3 ubiquitin protein ligase 1 |
| Reference | MIM:602212|HGNC:HGNC:10857|Ensembl:ENSG00000196470|HPRD:03736|Vega:OTTHUMG00000175417 |
| Gene type | protein-coding |
| Map location | 16q12.1 |
| Pascal p-value | 0.071 |
| Sherlock p-value | 0.378 |
| Fetal beta | 1.794 |
| DMG | 1 (# studies) |
| eGene | Cerebellar Hemisphere Myers' cis & trans |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 1 |
| GSMA_IIE | Genome scan meta-analysis (European-ancestry samples) | Psr: 0.01775 | |
| GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 2 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
| Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
|---|---|---|---|---|---|---|---|
| cg09123773 | 16 | 48419537 | SIAH1 | 4.476E-4 | -0.464 | 0.045 | DMG:Wockner_2014 |
eQTL annotation
| SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
|---|---|---|---|---|---|---|---|---|
| rs7960097 | chr12 | 51526736 | SIAH1 | 6477 | 0.13 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| MMRN2 | 0.80 | 0.81 |
| LRRC32 | 0.79 | 0.80 |
| CXorf36 | 0.75 | 0.77 |
| SLCO2B1 | 0.75 | 0.77 |
| TGM2 | 0.74 | 0.75 |
| VWF | 0.72 | 0.76 |
| TLN1 | 0.72 | 0.68 |
| CSPG4 | 0.70 | 0.76 |
| CD34 | 0.70 | 0.73 |
| ENG | 0.70 | 0.74 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| MTERFD3 | -0.51 | -0.56 |
| SNHG12 | -0.51 | -0.55 |
| ANAPC4 | -0.51 | -0.53 |
| C6orf203 | -0.50 | -0.51 |
| NDUFAF2 | -0.50 | -0.54 |
| ST20 | -0.50 | -0.57 |
| C8orf59 | -0.50 | -0.60 |
| MTIF3 | -0.50 | -0.54 |
| FRG1 | -0.49 | -0.52 |
| PDCD5 | -0.48 | -0.49 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0016874 | ligase activity | IEA | - | |
| GO:0016881 | acid-amino acid ligase activity | IEA | - | |
| GO:0008270 | zinc ion binding | IDA | 11863358 | |
| GO:0008022 | protein C-terminus binding | IPI | 11389840 | |
| GO:0046872 | metal ion binding | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0007411 | axon guidance | TAS | axon (GO term level: 13) | 9334332 |
| GO:0007399 | nervous system development | TAS | neurite (GO term level: 5) | 9334332 |
| GO:0006508 | proteolysis | TAS | 9334332 | |
| GO:0006511 | ubiquitin-dependent protein catabolic process | IEA | - | |
| GO:0007283 | spermatogenesis | IEA | - | |
| GO:0007049 | cell cycle | IEA | - | |
| GO:0009653 | anatomical structure morphogenesis | TAS | 9403064 | |
| GO:0006915 | apoptosis | TAS | 9403064 | |
| GO:0007275 | multicellular organismal development | IEA | - | |
| GO:0030154 | cell differentiation | IEA | - | |
| GO:0030163 | protein catabolic process | IDA | 11389840 | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005634 | nucleus | IEA | - | |
| GO:0005737 | cytoplasm | TAS | 9334332 |
Section IV. Protein-protein interaction annotation
| Interactors | Aliases B | Official full name B | Experimental | Source | PubMed ID |
|---|---|---|---|---|---|
| AFF4 | AF5Q31 | MCEF | MGC75036 | AF4/FMR2 family, member 4 | Two-hybrid | BioGRID | 16189514 |
| APC | BTPS2 | DP2 | DP2.5 | DP3 | GS | adenomatous polyposis coli | - | HPRD,BioGRID | 11389840 |
| BAG1 | RAP46 | BCL2-associated athanogene | - | HPRD,BioGRID | 9582267 |
| CACYBP | GIG5 | MGC87971 | PNAS-107 | RP1-102G20.6 | S100A6BP | SIP | calcyclin binding protein | - | HPRD,BioGRID | 11389839 |
| DAB1 | - | disabled homolog 1 (Drosophila) | - | HPRD,BioGRID | 12646221 |
| DCC | CRC18 | CRCR1 | deleted in colorectal carcinoma | - | HPRD,BioGRID | 9858595 |
| DCC | CRC18 | CRCR1 | deleted in colorectal carcinoma | DCC interacts with Siah-1. | BIND | 9334332 |
| DCC | CRC18 | CRCR1 | deleted in colorectal carcinoma | hSiah1 interacts with DCC cytoplasmic domain. | BIND | 9334332 |
| EIF3J | EIF3S1 | eIF3-alpha | eIF3-p35 | eukaryotic translation initiation factor 3, subunit J | - | HPRD,BioGRID | 9822659 |
| KHDRBS3 | Etle | SALP | SLM-2 | SLM2 | T-STAR | TSTAR | etoile | KH domain containing, RNA binding, signal transduction associated 3 | - | HPRD,BioGRID | 15163637 |
| KIF22 | KID | KNSL4 | OBP | OBP-1 | OBP-2 | kinesin family member 22 | - | HPRD,BioGRID | 11146551 |
| NUMB | S171 | numb homolog (Drosophila) | - | HPRD,BioGRID | 11752454 |
| PEG10 | Edr | HB-1 | KIAA1051 | MEF3L | Mar2 | Mart2 | RGAG3 | paternally expressed 10 | - | HPRD,BioGRID | 12810624 |
| PEG3 | DKFZp781A095 | KIAA0287 | PW1 | ZSCAN24 | paternally expressed 3 | - | HPRD,BioGRID | 10681424 |
| POU2AF1 | BOB1 | OBF-1 | OBF1 | OCAB | POU class 2 associating factor 1 | - | HPRD,BioGRID | 11483517 |11483518 |
| RBBP8 | CTIP | RIM | retinoblastoma binding protein 8 | Affinity Capture-Western Reconstituted Complex Two-hybrid | BioGRID | 14654780 |
| SIAH1 | FLJ08065 | HUMSIAH | Siah-1 | Siah-1a | hSIAH1 | seven in absentia homolog 1 (Drosophila) | - | HPRD,BioGRID | 9582267 |
| SKP1 | EMC19 | MGC34403 | OCP-II | OCP2 | SKP1A | TCEB1L | p19A | S-phase kinase-associated protein 1 | - | HPRD | 11389839 |
| SYP | - | synaptophysin | - | HPRD,BioGRID | 11786535 |
| TBL1X | EBI | SMAP55 | TBL1 | transducin (beta)-like 1X-linked | - | HPRD,BioGRID | 11389839 |
| TUBA1A | B-ALPHA-1 | FLJ25113 | LIS3 | TUBA3 | tubulin, alpha 1a | - | HPRD | 11146551 |
| TUBA1B | K-ALPHA-1 | tubulin, alpha 1b | - | HPRD | 11146551 |
| TUBA3C | TUBA2 | bA408E5.3 | tubulin, alpha 3c | - | HPRD | 11146551 |
| TUBA4A | FLJ30169 | H2-ALPHA | TUBA1 | tubulin, alpha 4a | - | HPRD | 11146551 |
| TUBA8 | TUBAL2 | tubulin, alpha 8 | - | HPRD | 11146551 |
| UBE2D1 | E2(17)KB1 | SFT | UBC4/5 | UBCH5 | UBCH5A | ubiquitin-conjugating enzyme E2D 1 (UBC4/5 homolog, yeast) | - | HPRD,BioGRID | 11389839 |
| UBE2E3 | UBCH9 | UbcM2 | ubiquitin-conjugating enzyme E2E 3 (UBC4/5 homolog, yeast) | Two-hybrid | BioGRID | 11389839 |
| UBE2I | C358B7.1 | P18 | UBC9 | ubiquitin-conjugating enzyme E2I (UBC9 homolog, yeast) | Ubc9 interacts with Siah-1. | BIND | 9334332 |
| UBE2I | C358B7.1 | P18 | UBC9 | ubiquitin-conjugating enzyme E2I (UBC9 homolog, yeast) | hSiah1 interacts with Ubc9. | BIND | 9334332 |
| VAV1 | VAV | vav 1 guanine nucleotide exchange factor | Two-hybrid | BioGRID | 10207103 |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| KEGG P53 SIGNALING PATHWAY | 69 | 45 | All SZGR 2.0 genes in this pathway |
| KEGG UBIQUITIN MEDIATED PROTEOLYSIS | 138 | 98 | All SZGR 2.0 genes in this pathway |
| KEGG WNT SIGNALING PATHWAY | 151 | 112 | All SZGR 2.0 genes in this pathway |
| REACTOME DEVELOPMENTAL BIOLOGY | 396 | 292 | All SZGR 2.0 genes in this pathway |
| REACTOME AXON GUIDANCE | 251 | 188 | All SZGR 2.0 genes in this pathway |
| REACTOME NETRIN1 SIGNALING | 41 | 30 | All SZGR 2.0 genes in this pathway |
| OSMAN BLADDER CANCER DN | 406 | 230 | All SZGR 2.0 genes in this pathway |
| GINESTIER BREAST CANCER ZNF217 AMPLIFIED UP | 78 | 48 | All SZGR 2.0 genes in this pathway |
| BILBAN B CLL LPL UP | 63 | 39 | All SZGR 2.0 genes in this pathway |
| ENK UV RESPONSE KERATINOCYTE DN | 485 | 334 | All SZGR 2.0 genes in this pathway |
| LAU APOPTOSIS CDKN2A UP | 55 | 40 | All SZGR 2.0 genes in this pathway |
| GRAESSMANN APOPTOSIS BY DOXORUBICIN UP | 1142 | 669 | All SZGR 2.0 genes in this pathway |
| IIZUKA LIVER CANCER PROGRESSION G1 G2 DN | 25 | 18 | All SZGR 2.0 genes in this pathway |
| FLECHNER BIOPSY KIDNEY TRANSPLANT OK VS DONOR UP | 555 | 346 | All SZGR 2.0 genes in this pathway |
| WANG TARGETS OF MLL CBP FUSION UP | 44 | 26 | All SZGR 2.0 genes in this pathway |
| GENTILE UV RESPONSE CLUSTER D4 | 55 | 37 | All SZGR 2.0 genes in this pathway |
| DAZARD RESPONSE TO UV SCC DN | 123 | 86 | All SZGR 2.0 genes in this pathway |
| GENTILE UV HIGH DOSE DN | 312 | 203 | All SZGR 2.0 genes in this pathway |
| KYNG DNA DAMAGE BY GAMMA AND UV RADIATION | 88 | 65 | All SZGR 2.0 genes in this pathway |
| KYNG DNA DAMAGE UP | 226 | 164 | All SZGR 2.0 genes in this pathway |
| WONG PROTEASOME GENE MODULE | 49 | 35 | All SZGR 2.0 genes in this pathway |
| MARTINEZ RB1 TARGETS UP | 673 | 430 | All SZGR 2.0 genes in this pathway |
| MARTINEZ TP53 TARGETS DN | 593 | 372 | All SZGR 2.0 genes in this pathway |
| MARTINEZ RB1 AND TP53 TARGETS DN | 591 | 366 | All SZGR 2.0 genes in this pathway |
| MATZUK SPERMATOCYTE | 72 | 55 | All SZGR 2.0 genes in this pathway |
| BLUM RESPONSE TO SALIRASIB UP | 245 | 159 | All SZGR 2.0 genes in this pathway |
| SWEET LUNG CANCER KRAS DN | 435 | 289 | All SZGR 2.0 genes in this pathway |
| MONTERO THYROID CANCER POOR SURVIVAL DN | 11 | 6 | All SZGR 2.0 genes in this pathway |
| RATTENBACHER BOUND BY CELF1 | 467 | 251 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-129-5p | 988 | 995 | 1A,m8 | hsa-miR-129brain | CUUUUUGCGGUCUGGGCUUGC |
| hsa-miR-129-5p | CUUUUUGCGGUCUGGGCUUGCU | ||||
| miR-135 | 390 | 396 | m8 | hsa-miR-135a | UAUGGCUUUUUAUUCCUAUGUGA |
| hsa-miR-135b | UAUGGCUUUUCAUUCCUAUGUG | ||||
| miR-140 | 198 | 204 | m8 | hsa-miR-140brain | AGUGGUUUUACCCUAUGGUAG |
| miR-141/200a | 25 | 31 | m8 | hsa-miR-141 | UAACACUGUCUGGUAAAGAUGG |
| hsa-miR-200a | UAACACUGUCUGGUAACGAUGU | ||||
| miR-15/16/195/424/497 | 446 | 452 | m8 | hsa-miR-15abrain | UAGCAGCACAUAAUGGUUUGUG |
| hsa-miR-16brain | UAGCAGCACGUAAAUAUUGGCG | ||||
| hsa-miR-15bbrain | UAGCAGCACAUCAUGGUUUACA | ||||
| hsa-miR-195SZ | UAGCAGCACAGAAAUAUUGGC | ||||
| hsa-miR-424 | CAGCAGCAAUUCAUGUUUUGAA | ||||
| hsa-miR-497 | CAGCAGCACACUGUGGUUUGU | ||||
| miR-193 | 22 | 28 | m8 | hsa-miR-193a | AACUGGCCUACAAAGUCCCAG |
| hsa-miR-193b | AACUGGCCCUCAAAGUCCCGCUUU | ||||
| miR-200bc/429 | 942 | 948 | m8 | hsa-miR-200b | UAAUACUGCCUGGUAAUGAUGAC |
| hsa-miR-200c | UAAUACUGCCGGGUAAUGAUGG | ||||
| hsa-miR-429 | UAAUACUGUCUGGUAAAACCGU | ||||
| miR-205 | 112 | 118 | m8 | hsa-miR-205 | UCCUUCAUUCCACCGGAGUCUG |
| miR-299-5p | 196 | 203 | 1A,m8 | hsa-miR-299-5p | UGGUUUACCGUCCCACAUACAU |
| miR-30-3p | 203 | 210 | 1A,m8 | hsa-miR-30a-3p | CUUUCAGUCGGAUGUUUGCAGC |
| hsa-miR-30e-3p | CUUUCAGUCGGAUGUUUACAGC | ||||
| miR-329 | 466 | 472 | 1A | hsa-miR-329brain | AACACACCUGGUUAACCUCUUU |
| miR-381 | 901 | 907 | m8 | hsa-miR-381 | UAUACAAGGGCAAGCUCUCUGU |
| miR-450 | 988 | 994 | 1A | hsa-miR-450 | UUUUUGCGAUGUGUUCCUAAUA |
| miR-486 | 143 | 149 | 1A | hsa-miR-486 | UCCUGUACUGAGCUGCCCCGAG |
| miR-488 | 1030 | 1036 | m8 | hsa-miR-488 | CCCAGAUAAUGGCACUCUCAA |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.