Gene Page: C6orf106
Summary ?
| GeneID | 64771 |
| Symbol | C6orf106 |
| Synonyms | FP852|dJ391O22.4 |
| Description | chromosome 6 open reading frame 106 |
| Reference | MIM:612217|HGNC:HGNC:21215|Ensembl:ENSG00000196821|HPRD:12837|Vega:OTTHUMG00000014553 |
| Gene type | protein-coding |
| Map location | 6p21.31 |
| Pascal p-value | 0.188 |
| Sherlock p-value | 0.555 |
| Fetal beta | -1.889 |
| eGene | Caudate basal ganglia Cortex Frontal Cortex BA9 Nucleus accumbens basal ganglia Meta |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
| GSMA_I | Genome scan meta-analysis | Psr: 0.033 | |
| GSMA_IIE | Genome scan meta-analysis (European-ancestry samples) | Psr: 0.04433 | |
| Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| HOLLMANN APOPTOSIS VIA CD40 UP | 201 | 125 | All SZGR 2.0 genes in this pathway |
| ZHONG RESPONSE TO AZACITIDINE AND TSA UP | 183 | 119 | All SZGR 2.0 genes in this pathway |
| CASORELLI ACUTE PROMYELOCYTIC LEUKEMIA DN | 663 | 425 | All SZGR 2.0 genes in this pathway |
| DEURIG T CELL PROLYMPHOCYTIC LEUKEMIA DN | 320 | 184 | All SZGR 2.0 genes in this pathway |
| SENESE HDAC3 TARGETS UP | 501 | 327 | All SZGR 2.0 genes in this pathway |
| SENESE HDAC3 TARGETS DN | 536 | 332 | All SZGR 2.0 genes in this pathway |
| ELVIDGE HYPOXIA DN | 146 | 94 | All SZGR 2.0 genes in this pathway |
| MARTORIATI MDM4 TARGETS FETAL LIVER DN | 514 | 319 | All SZGR 2.0 genes in this pathway |
| MOHANKUMAR TLX1 TARGETS UP | 414 | 287 | All SZGR 2.0 genes in this pathway |
| BUYTAERT PHOTODYNAMIC THERAPY STRESS UP | 811 | 508 | All SZGR 2.0 genes in this pathway |
| LU AGING BRAIN DN | 153 | 120 | All SZGR 2.0 genes in this pathway |
| JIANG VHL TARGETS | 138 | 91 | All SZGR 2.0 genes in this pathway |
| MONNIER POSTRADIATION TUMOR ESCAPE UP | 393 | 244 | All SZGR 2.0 genes in this pathway |
| FOSTER TOLERANT MACROPHAGE DN | 409 | 268 | All SZGR 2.0 genes in this pathway |
| SMID BREAST CANCER BASAL UP | 648 | 398 | All SZGR 2.0 genes in this pathway |
| BONOME OVARIAN CANCER SURVIVAL SUBOPTIMAL DEBULKING | 510 | 309 | All SZGR 2.0 genes in this pathway |
| LEE LIVER CANCER SURVIVAL UP | 185 | 112 | All SZGR 2.0 genes in this pathway |
| RUTELLA RESPONSE TO CSF2RB AND IL4 UP | 338 | 225 | All SZGR 2.0 genes in this pathway |
| RUTELLA RESPONSE TO HGF UP | 418 | 282 | All SZGR 2.0 genes in this pathway |
| RUTELLA RESPONSE TO HGF VS CSF2RB AND IL4 UP | 408 | 276 | All SZGR 2.0 genes in this pathway |
| JIANG HYPOXIA VIA VHL | 34 | 24 | All SZGR 2.0 genes in this pathway |
| WAKABAYASHI ADIPOGENESIS PPARG RXRA BOUND 8D | 882 | 506 | All SZGR 2.0 genes in this pathway |
| FORTSCHEGGER PHF8 TARGETS DN | 784 | 464 | All SZGR 2.0 genes in this pathway |
| RATTENBACHER BOUND BY CELF1 | 467 | 251 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-132/212 | 1706 | 1712 | m8 | hsa-miR-212SZ | UAACAGUCUCCAGUCACGGCC |
| hsa-miR-132brain | UAACAGUCUACAGCCAUGGUCG | ||||
| miR-135 | 323 | 329 | m8 | hsa-miR-135a | UAUGGCUUUUUAUUCCUAUGUGA |
| hsa-miR-135b | UAUGGCUUUUCAUUCCUAUGUG | ||||
| miR-153 | 1424 | 1430 | 1A | hsa-miR-153 | UUGCAUAGUCACAAAAGUGA |
| miR-182 | 1407 | 1413 | 1A | hsa-miR-182 | UUUGGCAAUGGUAGAACUCACA |
| miR-192/215 | 279 | 285 | m8 | hsa-miR-192 | CUGACCUAUGAAUUGACAGCC |
| hsa-miR-215 | AUGACCUAUGAAUUGACAGAC | ||||
| miR-370 | 3005 | 3012 | 1A,m8 | hsa-miR-370brain | GCCUGCUGGGGUGGAACCUGG |
| miR-377 | 180 | 187 | 1A,m8 | hsa-miR-377 | AUCACACAAAGGCAACUUUUGU |
| miR-448 | 1423 | 1430 | 1A,m8 | hsa-miR-448 | UUGCAUAUGUAGGAUGUCCCAU |
| miR-485-3p | 3245 | 3251 | m8 | hsa-miR-485-3p | GUCAUACACGGCUCUCCUCUCU |
| miR-504 | 1507 | 1514 | 1A,m8 | hsa-miR-504 | AGACCCUGGUCUGCACUCUAU |
| miR-9 | 1409 | 1415 | 1A | hsa-miR-9SZ | UCUUUGGUUAUCUAGCUGUAUGA |
| miR-96 | 1407 | 1413 | 1A | hsa-miR-96brain | UUUGGCACUAGCACAUUUUUGC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.