Gene Page: DCLRE1B
Summary ?
| GeneID | 64858 |
| Symbol | DCLRE1B |
| Synonyms | APOLLO|SNM1B|SNMIB |
| Description | DNA cross-link repair 1B |
| Reference | MIM:609683|HGNC:HGNC:17641|Ensembl:ENSG00000118655|HPRD:16785|Vega:OTTHUMG00000011937 |
| Gene type | protein-coding |
| Map location | 1p13.2 |
| Pascal p-value | 0.462 |
| Fetal beta | 1.119 |
| DMG | 1 (# studies) |
| eGene | Myers' cis & trans Meta |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DMG:Jaffe_2016 | Genome-wide DNA methylation analysis | This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. | 1 |
| GSMA_I | Genome scan meta-analysis | Psr: 0.0235 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
| Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
|---|---|---|---|---|---|---|---|
| cg26154367 | 1 | 114448170 | DCLRE1B | 8.57E-8 | -0.009 | 1.98E-5 | DMG:Jaffe_2016 |
eQTL annotation
| SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
|---|---|---|---|---|---|---|---|---|
| rs10860528 | chr12 | 100212518 | DCLRE1B | 64858 | 0.13 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0016787 | hydrolase activity | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0006281 | DNA repair | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005634 | nucleus | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| FULCHER INFLAMMATORY RESPONSE LECTIN VS LPS UP | 579 | 346 | All SZGR 2.0 genes in this pathway |
| LOPEZ MESOTELIOMA SURVIVAL TIME UP | 14 | 8 | All SZGR 2.0 genes in this pathway |
| KINSEY TARGETS OF EWSR1 FLII FUSION UP | 1278 | 748 | All SZGR 2.0 genes in this pathway |
| PASQUALUCCI LYMPHOMA BY GC STAGE UP | 283 | 177 | All SZGR 2.0 genes in this pathway |
| KAUFFMANN DNA REPAIR GENES | 230 | 137 | All SZGR 2.0 genes in this pathway |
| BILD E2F3 ONCOGENIC SIGNATURE | 246 | 153 | All SZGR 2.0 genes in this pathway |
| MARSON BOUND BY FOXP3 STIMULATED | 1022 | 619 | All SZGR 2.0 genes in this pathway |
| MARSON BOUND BY FOXP3 UNSTIMULATED | 1229 | 713 | All SZGR 2.0 genes in this pathway |
| MARSON BOUND BY E2F4 UNSTIMULATED | 728 | 415 | All SZGR 2.0 genes in this pathway |
| SANSOM APC TARGETS | 212 | 121 | All SZGR 2.0 genes in this pathway |
| RIGGI EWING SARCOMA PROGENITOR UP | 430 | 288 | All SZGR 2.0 genes in this pathway |
| BOYLAN MULTIPLE MYELOMA C D DN | 252 | 155 | All SZGR 2.0 genes in this pathway |
| CHANG CORE SERUM RESPONSE UP | 212 | 128 | All SZGR 2.0 genes in this pathway |
| DUTERTRE ESTRADIOL RESPONSE 24HR UP | 324 | 193 | All SZGR 2.0 genes in this pathway |
| LEE BMP2 TARGETS DN | 882 | 538 | All SZGR 2.0 genes in this pathway |
| KOINUMA TARGETS OF SMAD2 OR SMAD3 | 824 | 528 | All SZGR 2.0 genes in this pathway |
| VANOEVELEN MYOGENESIS SIN3A TARGETS | 220 | 133 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-149 | 944 | 950 | m8 | hsa-miR-149brain | UCUGGCUCCGUGUCUUCACUCC |
| hsa-miR-149brain | UCUGGCUCCGUGUCUUCACUCC | ||||
| miR-182 | 1012 | 1018 | 1A | hsa-miR-182 | UUUGGCAAUGGUAGAACUCACA |
| miR-370 | 1299 | 1305 | m8 | hsa-miR-370brain | GCCUGCUGGGGUGGAACCUGG |
| miR-421 | 1306 | 1312 | 1A | hsa-miR-421 | GGCCUCAUUAAAUGUUUGUUG |
| miR-495 | 913 | 919 | m8 | hsa-miR-495brain | AAACAAACAUGGUGCACUUCUUU |
| miR-96 | 1012 | 1018 | 1A | hsa-miR-96brain | UUUGGCACUAGCACAUUUUUGC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.