Summary ?
GeneID6536
SymbolSLC6A9
SynonymsGLYT1
Descriptionsolute carrier family 6 member 9
ReferenceMIM:601019|HGNC:HGNC:11056|Ensembl:ENSG00000196517|HPRD:03010|Vega:OTTHUMG00000008294
Gene typeprotein-coding
Map location1p33
Pascal p-value0.007
Fetal beta-0.662
DMG1 (# studies)
SupportNEUROTRANSMITTER METABOLISM

Gene in Data Sources
Gene set name Method of gene setDescriptionInfo
CV:GWASdbGenome-wide Association StudiesGWASdb records for schizophrenia
CV:PGCnpGenome-wide Association StudyGWAS
DMG:Wockner_2014Genome-wide DNA methylation analysisThis dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). 1
PMID:cooccurHigh-throughput literature-searchSystematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophreniasClick to show details
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 3 

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

ProbeChromosomePositionNearest geneP (dis)Beta (dis)FDR (dis)Study
cg25605771144466601SLC6A91.781E-40.2910.034DMG:Wockner_2014


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
GenePearson's Correlation Spearman's Correlation
CHAT0.720.57
SLC5A70.670.53
NTRK10.670.41
ECEL10.630.56
CHODL0.540.60
S100A100.530.17
ASPG0.510.27
LMO10.480.44
TACR10.480.32
GYG20.480.44
Top 10 negatively co-expressed genes
GenePearson's Correlation Spearman's Correlation
SLC26A4-0.20-0.16
FBXW7-0.19-0.16
ANKRD56-0.18-0.21
C6orf105-0.18-0.16
PRSS16-0.17-0.33
FBXO32-0.17-0.14
MEF2C-0.170.01
MCHR2-0.17-0.18
AC016910.1-0.17-0.06
C6orf142-0.17-0.21

Section III. Gene Ontology annotation

Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005328neurotransmitter:sodium symporter activityIEANeurotransmitter (GO term level: 9)-
GO:0005283sodium:amino acid symporter activityIEAglutamate (GO term level: 10)-
GO:0015375glycine:sodium symporter activityTAS8183239 
GO:0015293symporter activityIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006836neurotransmitter transportIEAneuron, Neurotransmitter (GO term level: 5)-
GO:0006865amino acid transportIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005624membrane fractionTAS8183239 
GO:0016020membraneIEA-
GO:0005887integral to plasma membraneIEA-
GO:0005887integral to plasma membraneTAS8183239 

Section V. Pathway annotation

Pathway namePathway size# SZGR 2.0 genes in pathwayInfo
REACTOME TRANSMEMBRANE TRANSPORT OF SMALL MOLECULES 413270All SZGR 2.0 genes in this pathway
REACTOME SLC MEDIATED TRANSMEMBRANE TRANSPORT 241157All SZGR 2.0 genes in this pathway
REACTOME TRANSPORT OF GLUCOSE AND OTHER SUGARS BILE SALTS AND ORGANIC ACIDS METAL IONS AND AMINE COMPOUNDS 8954All SZGR 2.0 genes in this pathway
REACTOME NA CL DEPENDENT NEUROTRANSMITTER TRANSPORTERS 1712All SZGR 2.0 genes in this pathway
REACTOME AMINE COMPOUND SLC TRANSPORTERS 2716All SZGR 2.0 genes in this pathway
ENK UV RESPONSE EPIDERMIS DN 508354All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY SERUM DEPRIVATION UP 552347All SZGR 2.0 genes in this pathway
LEIN MEDULLA MARKERS 8148All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS UP 1305895All SZGR 2.0 genes in this pathway
VALK AML CLUSTER 7 2816All SZGR 2.0 genes in this pathway
VERHAAK GLIOBLASTOMA CLASSICAL 162122All SZGR 2.0 genes in this pathway
WIERENGA STAT5A TARGETS UP 217131All SZGR 2.0 genes in this pathway
WIERENGA STAT5A TARGETS GROUP1 13676All SZGR 2.0 genes in this pathway
LEE BMP2 TARGETS UP 745475All SZGR 2.0 genes in this pathway
PARK OSTEOBLAST DIFFERENTIATION BY PHENYLAMIL UP 1311All SZGR 2.0 genes in this pathway
HUANG GATA2 TARGETS DN 7252All SZGR 2.0 genes in this pathway
FOSTER KDM1A TARGETS DN 211119All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-1379699751Ahsa-miR-137UAUUGCUUAAGAAUACGCGUAG
miR-141/200a166172m8hsa-miR-141UAACACUGUCUGGUAAAGAUGG
hsa-miR-200aUAACACUGUCUGGUAACGAUGU
hsa-miR-141UAACACUGUCUGGUAAAGAUGG
hsa-miR-200aUAACACUGUCUGGUAACGAUGU
miR-17-5p/20/93.mr/106/519.d245251m8hsa-miR-17-5pCAAAGUGCUUACAGUGCAGGUAGU
hsa-miR-20abrainUAAAGUGCUUAUAGUGCAGGUAG
hsa-miR-106aAAAAGUGCUUACAGUGCAGGUAGC
hsa-miR-106bSZUAAAGUGCUGACAGUGCAGAU
hsa-miR-20bSZCAAAGUGCUCAUAGUGCAGGUAG
hsa-miR-519dCAAAGUGCCUCCCUUUAGAGUGU
miR-1828318371Ahsa-miR-182UUUGGCAAUGGUAGAACUCACA
miR-184918924m8hsa-miR-184UGGACGGAGAACUGAUAAGGGU
miR-221/2229669721Ahsa-miR-221brainAGCUACAUUGUCUGCUGGGUUUC
hsa-miR-222brainAGCUACAUCUGGCUACUGGGUCUC
miR-30-5p1691761A,m8hsa-miR-30a-5pUGUAAACAUCCUCGACUGGAAG
hsa-miR-30cbrainUGUAAACAUCCUACACUCUCAGC
hsa-miR-30dSZUGUAAACAUCCCCGACUGGAAG
hsa-miR-30bSZUGUAAACAUCCUACACUCAGCU
hsa-miR-30e-5pUGUAAACAUCCUUGACUGGA
miR-75685751A,m8hsa-miR-7SZUGGAAGACUAGUGAUUUUGUUG
miR-93.hd/291-3p/294/295/302/372/373/520244250m8hsa-miR-93brainAAAGUGCUGUUCGUGCAGGUAG
hsa-miR-302aUAAGUGCUUCCAUGUUUUGGUGA
hsa-miR-302bUAAGUGCUUCCAUGUUUUAGUAG
hsa-miR-302cUAAGUGCUUCCAUGUUUCAGUGG
hsa-miR-302dUAAGUGCUUCCAUGUUUGAGUGU
hsa-miR-372AAAGUGCUGCGACAUUUGAGCGU
hsa-miR-373GAAGUGCUUCGAUUUUGGGGUGU
hsa-miR-520eAAAGUGCUUCCUUUUUGAGGG
hsa-miR-520aAAAGUGCUUCCCUUUGGACUGU
hsa-miR-520bAAAGUGCUUCCUUUUAGAGGG
hsa-miR-520cAAAGUGCUUCCUUUUAGAGGGUU
hsa-miR-520dAAAGUGCUUCUCUUUGGUGGGUU
miR-968308371A,m8hsa-miR-96brainUUUGGCACUAGCACAUUUUUGC