Summary ?
GeneID6549
SymbolSLC9A2
SynonymsNHE2
Descriptionsolute carrier family 9 member A2
ReferenceMIM:600530|HGNC:HGNC:11072|Ensembl:ENSG00000115616|HPRD:02756|Vega:OTTHUMG00000130778
Gene typeprotein-coding
Map location2q11.2
Pascal p-value0.003

Gene in Data Sources
Gene set name Method of gene setDescriptionInfo
CV:PGCnpGenome-wide Association StudyGWAS
GSMA_IGenome scan meta-analysisPsr: 0.0004 

Section I. Genetics and epigenetics annotation


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
GenePearson's Correlation Spearman's Correlation
NPTXR0.790.65
FAM120A0.750.75
TRIM90.750.77
STIM10.750.78
C2CD2L0.750.76
SLC8A20.750.65
SLC25A220.750.71
OTUD7A0.740.77
IQSEC20.740.69
WSCD20.740.73
Top 10 negatively co-expressed genes
GenePearson's Correlation Spearman's Correlation
FAM36A-0.40-0.42
C8orf59-0.39-0.46
RP9P-0.38-0.50
C21orf57-0.38-0.43
RPL31-0.37-0.48
NDUFAF2-0.37-0.40
FABP7-0.36-0.42
PFDN5-0.35-0.42
RPL24-0.35-0.46
RPL35-0.35-0.46

Section III. Gene Ontology annotation

Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0015385sodium:hydrogen antiporter activityTAS7683411 
GO:0015299solute:hydrogen antiporter activityIEA-
GO:0015297antiporter activityIEA-
GO:0031402sodium ion bindingIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0008104protein localizationIEA-
GO:0006814sodium ion transportIEA-
GO:0006811ion transportIEA-
GO:0006885regulation of pHIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0016020membraneIEA-
GO:0016021integral to membraneTAS7683411 

Section V. Pathway annotation

Pathway namePathway size# SZGR 2.0 genes in pathwayInfo
REACTOME TRANSMEMBRANE TRANSPORT OF SMALL MOLECULES 413270All SZGR 2.0 genes in this pathway
REACTOME SLC MEDIATED TRANSMEMBRANE TRANSPORT 241157All SZGR 2.0 genes in this pathway
REACTOME TRANSPORT OF INORGANIC CATIONS ANIONS AND AMINO ACIDS OLIGOPEPTIDES 9465All SZGR 2.0 genes in this pathway
MULLIGHAN NPM1 SIGNATURE 3 DN 162116All SZGR 2.0 genes in this pathway
SCHAEFFER PROSTATE DEVELOPMENT 48HR UP 487286All SZGR 2.0 genes in this pathway
BENPORATH SUZ12 TARGETS 1038678All SZGR 2.0 genes in this pathway
BENPORATH EED TARGETS 1062725All SZGR 2.0 genes in this pathway
BENPORATH ES WITH H3K27ME3 1118744All SZGR 2.0 genes in this pathway
BENPORATH PRC2 TARGETS 652441All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE UP 16911088All SZGR 2.0 genes in this pathway
WONG MITOCHONDRIA GENE MODULE 217122All SZGR 2.0 genes in this pathway
ZHENG IL22 SIGNALING DN 4226All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS UP 1305895All SZGR 2.0 genes in this pathway
VANTVEER BREAST CANCER BRCA1 DN 4428All SZGR 2.0 genes in this pathway
SHEDDEN LUNG CANCER POOR SURVIVAL A6 456285All SZGR 2.0 genes in this pathway
MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3 1069729All SZGR 2.0 genes in this pathway
MEISSNER NPC HCP WITH H3K4ME2 AND H3K27ME3 349234All SZGR 2.0 genes in this pathway
MIKKELSEN NPC HCP WITH H3K27ME3 341243All SZGR 2.0 genes in this pathway
BRUINS UVC RESPONSE VIA TP53 GROUP D 280158All SZGR 2.0 genes in this pathway
KUMAR PATHOGEN LOAD BY MACROPHAGES 275155All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-124/506264270m8hsa-miR-506UAAGGCACCCUUCUGAGUAGA
hsa-miR-124brainUAAGGCACGCGGUGAAUGCC
miR-130/301112311301A,m8hsa-miR-130abrainCAGUGCAAUGUUAAAAGGGCAU
hsa-miR-301CAGUGCAAUAGUAUUGUCAAAGC
hsa-miR-130bbrainCAGUGCAAUGAUGAAAGGGCAU
hsa-miR-454-3pUAGUGCAAUAUUGCUUAUAGGGUUU
miR-182170817141Ahsa-miR-182UUUGGCAAUGGUAGAACUCACA
miR-1911221128m8hsa-miR-19aUGUGCAAAUCUAUGCAAAACUGA
hsa-miR-19bUGUGCAAAUCCAUGCAAAACUGA
miR-262772831Ahsa-miR-26abrainUUCAAGUAAUCCAGGAUAGGC
hsa-miR-26bSZUUCAAGUAAUUCAGGAUAGGUU
hsa-miR-26abrainUUCAAGUAAUCCAGGAUAGGC
hsa-miR-26bSZUUCAAGUAAUUCAGGAUAGGUU
miR-495113911451Ahsa-miR-495brainAAACAAACAUGGUGCACUUCUUU
miR-96170717141A,m8hsa-miR-96brainUUUGGCACUAGCACAUUUUUGC